검색
검색 팝업 닫기

Ex) Article Title, Author, Keywords

JKFN Journal of the Korean Society of Food Science and Nutrition



Online ISSN 2288-5978

Article

home All Articles View

Article

Split Viewer

Journal of the Korean Society of Food Science and Nutrition 2024; 53(6): 545-557

Published online June 30, 2024 https://doi.org/10.3746/jkfn.2024.53.6.545

Copyright © The Korean Society of Food Science and Nutrition.

Inhibitory Effect of Herb Extract-Amino Acid Mixtures on UV-Induced Photoaging in HaCaT Cell

Ye-Lim You1 , Ha-Jun Byun1, Minha Kim2, Namgil Kang2, and Hyeon-Son Choi1

1Department of Food Nutrition, Sangmyung University
2Nutrione Co., Ltd.

Correspondence to:Hyeon-Son Choi, Department of Food Nutrition, Sangmyung University, 20, Hongjimun 2-gil, Jongno-gu, Seoul 03016, Korea, E-mail: hsc1970@smu.ac.kr

Received: February 13, 2024; Revised: March 7, 2024; Accepted: March 7, 2024

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

This study examined the optimal ratio of herb extract to amino acids, effectively protecting skin cells from UVB-induced photoaging. The response surface methodology program suggested seven mixture ratios of herb extracts, including ginger and star anise extracts. Among them, the H7 mixture showed the highest antioxidant activity. Arginine and glutamate were added to H7, producing HA1, HA2, and HA3 mixtures to determine their effects on UV-induced photoaging. The HA3 mixture had the highest protective effect against UV-induced cell death. HA3 significantly increased the mRNA expression of collagen 1, hyaluronic acid, and matrix metalloproteinase (1/2) while reducing the activity of hyaluronic acid lyase. HA3 significantly increased the expression of skin barrier genes, including filaggrin, loricrin, and involucrin. Overall, the HA3 mixture effectively protects skin cells from UV-induced photodamage. This study suggested an optimized herb extract/amino acid mixture ratio for developing skin-protective functional foods.

Keywords: photoaging, HaCaT cell, herb extract, glutamic acid, arginine

피부는 병원체, 화학적 독소, 기계적 스트레스 등 다양한 유해한 환경 자극으로부터 신체를 보호하는 외부 장벽으로서 표피와 진피를 포함하는 여러 층으로 구성되어 있다(McKnight 등, 2022). 피부는 또한 체내 수분과 온도를 조절 및 보존하여 항상성을 유지함은 물론, 체내 물질교환과 감각을 전달하는 기능을 함으로써 육체의 건강뿐만 아니라 웰빙에 기여하는 중요한 역할을 한다(McKnight 등, 2022). 피부의 노화는 피부를 구성하는 세포들의 회복 능력의 저하 등 복잡한 생물학적 과정이 진행되는 현상으로 외부환경과 개인의 생물학적인 특성에 따라 영향을 받는다(Wong과 Chew, 2021). 피부 노화는 보통 시간 흐름에 따라 발생하는 노화인 내인성 노화와 자외선 노출이 주요 원인으로 작용하는 외인성 노화로 분류되며 특히, 외인성 노화는 광노화로 불린다(Domaszewska-Szostek 등, 2021; Parrado 등, 2019). 내인성 노화는 면역기능 억제, 표피 항상성 불균형, 호르몬 변화, 연령 증가, 스트레스 또는 개인의 유전적인 요인에 의해서 발생하며, 대개 세포 수가 감소함에 따라 탄력이 감소하고 수분 손실로 인하여 각질층 구조가 변하는 미세한 주름, 피하지방층 감소 등의 임상적인 특징을 가지지만 비교적 경미하다(Domaszewska-Szostek 등, 2021). 반면 외인성 노화는 햇볕, 대기오염, 흡연 등 환경의 영향을 받으며 특히 자외선의 자극으로 인하여 활성산소종(reactive oxygen species)이 증가하고 산화스트레스가 유발됨으로써 발생한다(Wong과 Chew, 2021). 자외선은 파장이 짧은 비이온화 방사선(100~400 nm)으로 자외선이 가지고 있는 에너지와 반응 특성을 이용하여 의학, 산업, 미용의 용도로 사용되어 왔다(Juzeniene과 Moan, 2012). 햇빛에 의한 UV의 적절한 노출은 체내 비타민 D 생성 등 인체의 건강에 유익한 작용을 할 수 있지만, 과도한 햇빛을 통한 자외선 노출이 증가하면 피부 건강에 해로운 결과를 초래한다. 피부의 주름형성 증가, 탄력 상실, 피부의 두께 증가 등의 미용적인 면에서부터 피부암에 이르기까지 광범위한 위험이 내포되어 있다. 이러한 과도한 자외선 노출은 현재 환경문제로 대두되는 오존층 파괴로 인해 더 심화되고 있다(Verma 등, 2024).

자외선에 의한 피부세포 내 산화스트레스 증가는 염증 및 기질 분해와 관련된 여러 전사인자를 활성화함으로써 염증성 사이토카인을 증가시키고 기질 단백질을 분해하는 효소를 증가시키거나 합성하는 효소를 억제함으로써 피부 내 콜라겐, 히알루론산, 엘라스틴과 같은 건강한 피부를 유지하는 데 필수적인 성분을 감소시킨다(de Jager 등, 2017). 피부에서 가장 흔하게 발견되는 콜라겐은 피부의 구조적 지지력과 탄력성을 제공하고 새로운 세포가 성장하고 재생될 수 있는 복잡한 섬유조직 네트워크를 형성하는 큰 역할을 한다(Al-Atif, 2022).

피부의 장력과 강도, 탄력을 유지하며 피부 보호 역할을 하는 기질 단백질은 자외선 노출에 의한 광노화와 함께 감소하며 굵고 깊은 주름의 발생이 이어진다. 또한, 피부가 건조해지고 탄력성이 감소하는 증상을 나타내고 피부 건조, 색소 침착, 말초혈관 확장 등의 임상적 특징을 나타낸다(Al-Atif, 2022; Kim 등, 2022). 따라서 피부를 자외선 빛으로부터 차단하는 여러 상업용 제품이 상용화되어 왔으며 피부에 바르는 용도로서의 재료뿐만 아니라 식용의 천연재료를 사용하여 자외선에 의한 광노화를 억제하고 이너뷰티를 표방하는 방법이 꾸준히 연구되고 있다(Verma 등, 2024).

일부 식물 또는 허브 추출물은 활성산소를 제거하고 피부 내 기질을 분해하는 효소를 억제하며, 콜라겐의 합성을 촉진하는 역할을 통해 건강한 피부세포를 유지하는 데 기여하는 것으로 알려진다(Chen 등, 2012; Kwon 등, 2021; Li 등, 2020). 또한, 일부 아미노산들은 피부의 섬유아세포 증식을 촉진하거나 콜라겐 합성에 원료로 이용되어 피부의 상처치료를 돕는 등 피부에 긍정적인 영향을 끼치는 것으로 보고되었다(Albaugh 등, 2017; Stechmiller 등, 2005). 특히, Kwon 등(2022)은 아르기닌과 글루탐산의 이온쌍이 레이저 노출에 의한 피부세포의 손상을 막고 세포 내 콜라겐 생성을 촉진할 수 있다고 보고하였다. 따라서 본 연구에서는 항산화 활성에 기반하여 피부주름, 노화의 방지 및 건강한 피부세포를 유지하는 데 도움을 주는 것으로 보고된 허브류 중 식품산업에서 상용되고 있는 다섯 가지(적포도, 스타아니스, 생강, 헤마토코쿠스, 알로에베라) 허브들(Chen 등, 2012; Kim 등, 2019; Kwon 등, 2021; Li 등, 2020; Tanaka 등, 2017)과 피부 손상 및 상처를 복구하고 피부세포의 증식과 콜라겐 생성을 촉진하는 것으로 알려진 아미노산으로 아르기닌과 글루탐산(Albaugh 등, 2017; Stechmiller 등, 2005)의 혼합물에 대해 광노화를 유도한 세포주에서 광노화 억제 활성을 평가하고 최적의 허브-아미노산 배합 비율을 선정하여 피부미용 소재로의 활용 가능성을 제시하고자 한다.

실험재료

본 실험에 사용한 5종류의 허브 추출물(헤마토코쿠스 추출물, 알로에베라 추출물, 적포도 추출물, 생강 추출물, 스타아니스 추출물)과 아미노산(아르기닌, 글루탐산)은 (주)뉴트리원으로부터 제공받았다. 각 시료 분말의 정보는 다음과 같다. 적포도(Vitis vinifera) 추출물(적포도 농축 분말 31%, 덱스트린 64.4%, 검류아라비아검 4.6%), 스타아니스(Illicium verum) 추출물(스타아니스 분말 100%), 생강(Zingiber officinale) 추출물(생강 분말 100%), 헤마토코쿠스(Haematococcus pluvialis) 추출물(헤마토코쿠스 추출 분말 100%), 알로에베라(Aloe vera) 추출물(알로에베라 겔 건조 분말 50%, 덱스트린 50%), 글루탐산(L-글루탐산 100%), 아르기닌(L-아르기닌 100%)이 본 연구에 사용되었다.

허브 추출물 및 아미노산 배합비

5종류 허브 추출물의 최적 배합비를 도출하기 위해 response surface methodology를 이용하였으며 배합비 경우의 수는 Supplementary Table 1과 같다. 37개의 배합비 중 5개 허브 추출물을 모두 포함하는 배합(Table 1, H1~H7)을 대상으로 실험에 이용하였다. 이 중 항산화 활성이 가장 우수한 배합비를 선정하고 아미노산인 아르기닌과 글루탐산을 전체 배합 50%의 비중으로 1:3, 1:1, 3:1의 비율로 배합하여 피부세포실험에 이용하였다. 시료들은 농도별로 ddH2O 또는 dimethyl sulfoxide(DMSO)에 용해한 후 실험에 이용하였다.

Table 1 . Mixture ratio of herb extracts by RSM

RunHaematococcusAloe veraRed grapeGingerStar anise
H10.600.100.100.100.10
H20.100.600.100.100.10
H30.100.100.600.100.10
H40.100.100.100.600.10
H50.100.100.100.100.60
H60.200.200.200.200.20
H70.050.050.300.300.30

RSM: response surface methodology.



총당 측정

총당은 페놀-황산법을 이용해 정량하였다(Masuko 등, 2005). 표준물질로는 dextrose(Sigma-Aldrich)를 사용하였다. 각 시료를 준비한 뒤 시료 0.2 mL에 5% 페놀 용액 0.2 mL를 넣고 섞어준 후 황산 1.0 mL를 넣고 섞어준 뒤 상온에서 20분 식힌 후 microplate에 200 μL씩 분주하고 microplate reader(INNO-M, LTek)를 이용하여 490 nm에서 흡광도를 측정하였다. Dextrose의 농도별(mg/mL) 평균 흡광도를 그래프로 나타내 표준곡선을 구했고 이를 이용해 각 시료의 총당을 계산하여 mg glucose/g으로 나타내었다. 시료는 0.1 mg/mL 농도로 녹여 사용하였다.

총 폴리페놀 측정

총 폴리페놀 함량은 Folin-Denis의 방법을 응용하여 측정하였다(Velioglu 등, 1998). Gallic acid(Sigma-Aldrich)와 각 시료를 준비한 뒤 시료 0.01 mL에 3차 증류수 0.79 mL를 가하여 섞어준 뒤 20% sodium carbonate solution 0.15 mL를 첨가해 섞어주고 0.9 N Folin-Ciocalteu 0.05 mL를 첨가하고 상온 암실에서 30분간 반응시킨 후 microplate에 200 μL씩 분주하여 microplate reader(INNO-M, LTek)에서 흡광도(750 nm)를 측정하였다. Gallic acid의 평균 흡광도와 mg/mL 농도를 그래프로 나타내 표준곡선을 구하고 각 시료의 총 폴리페놀 함량을 계산하여 mg GAE/g으로 나타내었다. 헤마토코쿠스 추출물, 알로에베라 추출물, 적포도 추출물은 100 mg/mL의 농도로 물에 녹여 사용하였고 생강 추출물, 스타아니스 추출물은 50 mg/mL 농도로 녹여 사용하였다.

총 플라보노이드 측정

Catechin(Sigma-Aldrich)과 각 시료를 준비한 뒤 microplate에 각 시료를 50 μL씩 분주하고 5% NaNO2 30 μL를 분주하여 섞어준 후 암실에서 5분간 반응시켰다. 2% AlCl3 60 μL를 추가로 분주하여 섞은 후 암실에서 6분간 반응시키고, 4% NaOH 100 μL를 넣어 섞고 암실에서 11분간 반응시켰다(Zhishen 등, 1999). 반응이 완료되면 microplate reader(INNO-M, LTek)를 이용하여 510 nm에서 흡광도를 측정하였다. Catechin의 평균 흡광도와 mg/mL 농도를 그래프로 나타내 표준곡선을 구하고 각 시료의 총 플라보노이드 함량을 계산하여 mg CE/g으로 나타내었다. 헤마토코쿠스 추출물, 알로에베라 추출물, 적포도 추출물은 100 mg/mL의 농도로 녹여 사용하였고 생강 추출물, 스타아니스 추출물은 10 mg/mL 농도로 녹여 사용하였다.

ABTS 라디칼 소거 활성 측정

2,2′-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)(ABTS) 시약은 7 mM ABTS(diammonium salt, Sigma-Aldrich)와 2.45 mM 과황산칼륨 용액을 1:1로 희석한 후 암실에서 24시간 보관 후 사용하였다. 시료는 ddH2O에 녹여 사용하였으며 96-well plate에 시료 10 μL 분주 후 ABTS 시약 200 μL를 분주해 혼합하였다. 암실에서 30분간 반응시킨 후 414 nm에서 반응액의 흡광도를 측정하였다(van den Berg 등, 1999). 대조군은 ascorbic acid를 사용하였으며 ascorbic acid의 농도별 평균 흡광도를 그래프로 나타내 표준곡선을 구한 후 각 시료의 ABTS 라디칼 소거 활성을 계산하여 mg ascorbic acid equivalent(AAE)/g으로 나타내었다. 시료는 1 mg/mL 농도로 녹여 사용하였다. 또한, HA1, HA2, HA3의 항산화 활성 비교를 위해 각 시료의 농도별 ABTS 라디칼 소거 활성을 구한 후 IC50(concentration required to inhibit ABTS radical by 50%)값으로 나타내었다. ABTS 라디칼 소거 활성은 반응 용액과 대조군의 흡광도 차이를 백분율로 환산하여 확인하였다.

FRAP 환원 활성 측정

Ferric reducing antioxidant power(FRAP) 시약은 300 mM acetate buffer(pH 3.6), 10 mM TPTZ in 40 mM HCl, 20 mM iron(Ⅲ) chloride hexahydrate(FeCl3・6H2O)를 10:1:1로 희석하여 사용하였으며 시료는 DMSO에 녹여 사용하였다. Microplate에 각 시료를 10 μL씩 분주한 후 FRAP 시약 200 μL를 분주하여 섞어준 후 37°C incubator에서 5분간 반응 후 microplate reader(INNO-M, LTek)를 이용하여 593 nm에서 흡광도를 측정하였다(Benzie와 Strain, 1999). 대조군은 ascorbic acid를 사용하였으며 ascorbic acid의 평균 흡광도와 μg/mL 농도를 그래프로 나타내 표준곡선을 구한 후 각 시료의 FRAP 환원 활성을 계산하여 mg AAE/g으로 나타내었다. 시료는 1 mg/mL 농도로 녹여 사용하였다.

세포 생존율

HaCaT(Amorepacific Co.) 세포를 10% fetal bovine serum과 1% penicillin-streptomycin이 함유된 Dulbecco’s modified Eagle’s medium 배지에서 배양하면서 세포 밀도가 70%가 되면 계대배양을 해주면서 세포를 유지하였다. 피부세포를 1.5×104~1.0×105 cells/well의 밀도로 96-well plate에 분주한 뒤 24시간 동안 배양하고 배합비 등의 시료를 농도별로 처리한 후 다시 24시간 동안 배양하여 세포에 충분히 반응시켰다. 24시간 후 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT) 시약(0.5 mg/mL, Sigma-Aldrich)이 함유된 무혈청 배지로 배지를 교환하고 1시간 동안 37°C에서 정치시킨다. 배지를 제거한 후 DMSO를 각 well에 분주하고 MTT formazan을 용해한 후 550 nm에서 흡광도(Spectra Max M3, Molecular Devices)를 측정하였다.

피부세포의 자외선 조사 및 시료 처리

피부세포를 1.0×105 cells/well의 밀도로 6-well plate에 분주하고 24시간 배양하였다. 이후 시료를 농도별로 배지에 녹여 배지를 교환하면서 처리한 후 2시간 뒤 다시 배지를 제거하고 phosphate-buffered saline(PBS)으로 교환한 후 30~35초간 자외선 조사를 실시하였다(30 mJ/cm2). 이후 PBS를 다시 시료가 포함된 배지로 교환한 후 24시간 동안 배양하였다. 24시간 후 세포를 회수하여 RNA를 추출하였다.

Real-time PCR

회수한 세포로부터 TRIzol 시약(Invitrogen)을 이용하여 제공된 protocol에 따라 total RNA를 추출하였다. 총 RNA를 정량한 후 1 μg에 역전사 효소(reverse transcriptase)가 포함된 Maxime RT PreMix kit(iNtRON Biotechnology)을 이용하여 cDNA를 합성하였다. 합성된 cDNA에 SYBR Green PCR master mix(Applied Biosystem)와 primer(100 ng/mL)를 혼합하여 PCR을 진행하였다. PCR은 AriaMX real-time PCR system(Agilent Technology)을 이용하여 진행하였다. 본 실험에 사용된 primer 리스트는 Table 2에 나타내었다.

Table 2 . Primers used in this study

Oligo nameStartSequence (5’ to 3’)Accession number
MMP1F
R
ATGAAGCAGCCCAGATGTGAG
TGGTCCACATCTGCTCTTGGCA
NM_001297436.2

MMP2F
R
TGCTACACGGATACCCCAAG
GCAGCATCGATATGCTTCACAG
NM_004530

HAS1F
R
CTGCGATACTGGGTAGCCTTCA
CCAGAACTTCTGGTTGTACCAG
NM_001523.4

HYAL1F
R
GGCCAGGGCTTCCTCAAATA
CTGTGACAGTGGCTGAGTGT
NM_054346414.1

FilaggrinF
R
GCTGAAGGAACTTCTGGAAAAGG
GTTGTGGTCTATATCCAAGTGATC
NM_002016
Collagen 1F
R
GATTCCCTGGACCTAAAGGTGC
AGCCTCTCCATCTTTGCCAGCA
NM_000088

InvolucrinF
R
CTGCCTCAGCCTTACTGTGA
GGAGGAACAGTCTTGAGGAG
NM_002016

LoricrinF
R
GCAACCTCGGGTAGCATCA
GCCGTCCAAATAGATCCCC
NM_002016

MMP-1/2: matrix metalloproteinase 1/2, HAS: hyaluronic acid synthase, HYAL1: hyaluronic acid lyase. F: forward, R: reverse.



통계처리

실험 결과는 평균±표준편차로 나타내었으며, IBM SPSS statistics 27을 이용하여 일원배치 분산분석을 한 후 유의한 차이가 있는 경우 Duncan 법을 이용해 P<0.05 수준에서 차이에 대한 유의성을 검증하였다.

허브 추출물의 총당, 폴리페놀 및 플라보노이드 함량

다섯 종류 허브 추출물의 총당, 총 폴리페놀 및 총 플라보노이드 함량을 측정한 결과 당 함량은 적포도 추출물이 가장 많은 1,494.76 mg glucose/g의 함량을 보였으며 다음으로 생강 추출물(1,038.98 mg glucose/g), 헤마토코쿠스 추출물(890.68 mg glucose/g), 알로에베라 추출물(528.77 mg glucose/g)의 순으로 총당 함량을 보였고 스타아니스 추출물이 318.57 mg glucose/g으로 가장 낮은 함량을 보였다(Table 3). 폴리페놀 함량은 스타아니스 추출물이 30.06 mg GAE/g으로 가장 높게 나왔으며, 생강 추출물이 18.77 mg GAE/g, 헤마토코쿠스 추출물과 적포도 추출물이 1.63 mg GAE/g, 1.59 mg GAE/g의 함량을 보였고 알로에베라 추출물은 폴리페놀이 검출되지 않았다. 플라보노이드의 함량도 폴리페놀 함량과 비슷한 경향을 보여 스타아니스 추출물이 17.18 mg CE/g으로 가장 높았으며 생강 추출물(7.64 mg CE/g)이 뒤를 이었다. 헤마토코쿠스 추출물과 적포도 추출물은 각각 1.12 mg CE/g, 0.34 mg CE/g의 플라보노이드 함량을 보였지만 알로에베라 추출물의 플라보노이드는 검출되지 않았다.

Table 3 . Total sugar and polyphenol content of herb extracts

Herb extractsTotal sugar (mg glucose/g)Total polyphenol (mg GAE/g)Total flavonoid (mg CE/g)
Haematococcus890.68±8.89c1.63±0.10c1.12±0.00c
Aloe vera528.77±4.71d0.00±0.00d0.00±0.00e
Red grape1,494.76±10.60a1.59±0.38c0.34±0.00d
Ginger1,038.98±15.31b18.77±0.47b7.64±0.21b
Star anis318.57±8.24e30.06±0.10a17.18±0.72a

GAE: gallic acid equivalent, CE: catechin equivalent. Means within a column not followed by the same letter (a-e) are significantly different at P<0.05.



폴리페놀은 구조적으로 2개 이상의 페닐기 그룹에 여러 개의 히드록실기가 결합된 방향성 알콜 물질로 식물에서 주로 색소나 쓴맛을 나타내는 특징이 있다(Lee와 Park, 2022). 플라보노이드는 대표적인 폴리페놀 화합물의 일종으로 2개의 페닐기 프로판 탄소골격과 2개의 벤젠고리 A와 B로 이루어져 있다. 이들이 선형으로 연결된 3개의 탄소 사슬(C6-C3-C6) 구조를 가지며 중심 탄소 사슬에는 닫힌 pyran 고리 C가 형성된다(Mutha 등, 2021). 대체로 이러한 폴리페놀 및 플라보노이드는 식물 내에서 당의 이차대사산물로서 외부 환경으로부터 자신을 보호하는 역할을 하며, 사람을 비롯한 동물의 몸에서도 활성산소를 제어하는 역할을 통해 산화스트레스를 조절하고 여러 질병의 발생 위험을 낮출 수 있는 것으로 보고된다(Kim 등, 2015; Mutha 등, 2021). 특히, 이들 식물 유래 폴리페놀은 피부의 노화 개선 작용을 하는 물질로 알려져 건강기능식품, 화장품 등에 많이 사용된다(Lee와 Park, 2022).

허브 추출물 배합의 항산화 활성

일곱 가지 허브 추출물 배합비(H1~H7)에 대해서 ABTS 라디칼 소거 활성과 FRAP 환원능을 측정하여 비교한 결과는 Table 4에 나타내었다. ABTS 소거 활성은 H7이 30.79 mg AAE/g으로 가장 높은 활성을 나타냈으며 H4 22.37 mg AAE/g, H5 20.83 mg AAE/g 순으로 ABTS 소거 활성이 높았고 H2의 ABTS 소거 활성이 가장 낮은 값(2.64 mg AAE/g)을 나타내었다. FRAP 환원능도 H7이 34.50 mg AAE/g으로 가장 높은 값을 보였으며 H5 19.31 mg AAE/g, H4 15.23 mg AAE/g, H6 10.35 mg AAE/g의 순으로 FRAP 환원능을 보였고 H1이 가장 낮은 4.13 mg AAE/g의 환원능을 나타내었다. 본 실험에 사용된 배합비(H1~H7) 중 H7이 가장 높은 ABTS 소거 활성과 FRAP 환원능을 보임으로써 아미노산 첨가 전 허브 추출물 최적 배합비를 H7로 결정하였다. H7이 항산화 활성이 상대적으로 우수하게 나온 이유는 폴리페놀 함량이 상대적으로 많은 스타아니스 추출물과 생강 추출물이 1:1의 비율로 총배합의 60%를 차지했기 때문으로 사료된다. H4와 H5의 경우 스타아니스 추출물과 생강 추출물이 총배합의 70%를 차지하지만 스타아니스 추출물 또는 생강 추출물 어느 한쪽이 압도적으로 많은 6:1 또는 1:6의 비율로 조성되어 있다. 이는 한 가지의 허브 추출물보다 두 가지 허브 추출물을 혼합함으로써 항산화 활성에 기여하는 폴리페놀이 증가하는 것으로 사료된다(Beom 등, 2021). 스타아니스와

Table 4 . ABTS radical scavenging and FRAP reducing activities of herb mixtures

Sample No.Antioxidant activity of herb mixture

H1H2H3H4H5H6H7
ABTS (mg AAE/g)3.75±0.42d2.64±0.88d3.12±0.34d22.37±1.14b20.83±0.10b13.03±1.20c30.79±2.52a
FRAP (mg AAE/g)4.13±0.08g6.07±0.08e5.12±0.07f15.23±0.90c19.31±0.10b10.35±0.85d34.50±1.30a

AAE: ascorbic acid equivalent. Means within a row not followed by the same letter (a-g) are significantly different at P<0.05.



생강에 대한 항산화 활성은 여러 연구에서 보고되었다. 스타아니스 메탄올 추출물은 ABTS와 DPPH 라디칼 소거 활성에서 각각 95.10 Trolox mg/g과 77.70 Trolox mg/g의 활성을 보였으며, 이러한 스타아니스의 항산화 활성은 LPS로 유도된 동물의 염증 반응을 효과적으로 억제하는 것으로 보인다(Majali, 2022). 특히, 비타민 C 성분인 아스코빈산과 비슷한 효과를 보이는 것으로 보고되었다(Majali, 2022). 스타아니스의 주된 성분은 trans-anethole로 항산화, 항염증 및 항비만 활성을 나타내는 것으로 알려져 있다(Sharafan 등, 2022). 생강 또한 항산화뿐만 아니라 항암, 항염, 항당뇨 작용 등에 대한 생리활성을 갖는 것으로 알려졌다(Mashhadi 등, 2013). 이러한 생강의 생리활성을 나타내는 주된 성분은 진저롤(gingerol), 쇼가올(shogaol) 등이 보고된다(Mashhadi 등, 2013). 특히, Lee 등(2008)은 생강의 [6]-gingerol이 유방암세포의 전이 작용을 억제하는 것으로 보고하였다. 다른 허브에 대해서도 항산화 활성이 보고되고 있지만(Liu 등, 2018; Pogorzelska 등, 2018), 본 연구에서는 스타아니스 추출물과 생강 추출물의 항산화 활성이 더 높게 나온 것으로 보인다. 또한 허브류의 항산화 활성은 추출용제에 따라서 달라질 수 있는데, 본 실험에서는 추출용제에 대한 정보 없이 이미 제품화된 분말을 제공받아 활성을 분석한 경우로 추후 추출용제에 따른 활성의 차이에 대한 실험을 통해 설명할 수 있을 것이다. 본 연구에서는 다섯 가지 허브 추출물을 다 포함하는 조건에서 실험하였다. 이들 허브류는 피부 건강 및 보호에 관해 많은 연구가 보고되어 있다. 포도 껍질이 인간 피부 표피세포에서 자외선에 의한 DNA 손상을 억제할 수 있으며(Song 등, 2020), 생강 물 추출물과 메탄올 추출물은 자외선을 흡수하는 성질에 기인하여 자외선 차단제로서의 가능성도 제기되었다(Suva, 2014). 헤마토코쿠스 내의 아스타잔틴이 인간 피부세포와 랫트에서 산화스트레스와 염증반응을 억제하고 콜라겐 생성을 촉진하는 것으로 보고되었으며(Chou 등, 2020), 알로에베라 추출물 또한 자외선으로 유도된 마우스의 피부 노화현상을 완화하는 것이 보고되었다(Misawa 등, 2017). Sung 등(2012)은 스타아니스 추출물이 인간 각질형성세포인 HaCaT에서 염증성 사이토카인의 발현을 저해하여 항염증성을 나타낸다고 보고하였다.

아미노산 첨가 배합비별 항산화 활성 및 피부세포 세포 생존율에 대한 효과

항산화 활성을 통해서 선정된 H7과 피부세포의 재생 효과가 보고된 2개의 아미노산(아르기닌과 글루탐산)을 혼합하여 피부세포실험을 위한 배합비를 설정하였고 Table 5에 나타내었다(HA1, HA2, HA3). 우선 H7에 아미노산이 포함된 3가지의 배합비별 항산화 활성을 측정한 결과 아르기닌:글루탐산이 3:1의 비율로 포함된 HA3이 가장 높은 ABTS 소거 활성을 나타내었다(Fig. 1). HA3은 25.04 mg AAE/g으로 HA1의 7.89 mg AAE/g보다 3.2배 이상 높았고 HA2의 13.42 mg AAE/g보다 2배가량 높은 항산화 활성을 보였다. IC50값을 비교한 결과에서도 같은 경향을 보였다(Table 6). 즉 HA3의 IC50값이 3.65 mg/mL로 가장 낮은 값을 보여 활성이 가장 높음을 나타냈고 HA2(7.62 mg/mL), HA1(8.58 mg/mL)의 순으로

Table 5 . Ratio of herb mixture added glutamate and arginine

RunHaematococcusAloe veraRed grapeGingerStar anisArginineGlutamate
H70.0500.0500.3000.3000.300
HA10.0250.0250.1500.1500.1500.1250.375
HA20.0250.0250.1500.1500.1500.2500.250
HA30.0250.0250.1500.1500.1500.3750.125

Table 6 . ABTS IC50 value of HA1, HA2, and HA3

SampleABTS IC50

HA1HA2HA3
mg/mL8.58±0.65a7.62±0.35a3.65±0.28b

IC50: concentration required to inhibit ABTS radical by 50%. Means within a row not followed by the same letter (a,b) are significantly different at P<0.05.


Fig. 1. ABTS scavenging (A) and FRAP reducing (B) activities of HA1, HA2, and HA3. Each number is a mean of three observations. All values represent mean±SD. Means of bars not followed by the same letter (a-c) are significantly different at P<0.05.

ABTS 소거 활성을 보였다. 따라서 아미노산 2종이 추가된 배합비 중 아르기닌이 상대적으로 많이 함유된 배합비가 상대적으로 높은 항산화 활성을 보였다. 하지만 HA3의 ABTS 소거 활성은 아미노산이 제외된 H7의 ABTS 소거 활성인 30.79 mg AAE/g보다는 낮은 활성을 보였는데, 이는 아미노산을 첨가하면서 스타아니스 추출물과 생강 추출물의 첨가 비율이 감소한 것이 영향을 미쳤을 것으로 사료된다.

그럼에도 불구하고 아미노산 및 아미노산 유도체들의 항산화 능력에 관한 연구가 많이 보고되어 왔다(Esteves 등, 2022; Hwang 등, 2019; Xu 등, 2017). Hwang 등(2019)은 180°C의 온도에서 아미노산의 항산화 활성을 측정하였는데 아르기닌, 시스테인, 리신, 메티오닌, 트립토판의 아미노산들은 5.5 mM의 농도에서 대표적인 항산화제인 tertiary-butylhydroquinone(1.1 mM)의 항산화능보다 훨씬 높았다고 보고하였다. 또한, Xu 등(2017)은 20개 표준아미노산의 항산화 능력을 환원 적정법에 근거하여 비교 분석한 결과 아르기닌, 시스테인, 리신, 히스티딘, 메티오닌, 트립토판, 티로신의 7개 아미노산이 다른 13개의 표준아미노산보다 항산화 활성이 우수하였다고 보고하였다. 본 연구에서는 항산화 활성이 우수한 아미노산으로 아르기닌이 포함되어 있어 배합비들의 항산화 활성에 기여할 수 있다고 볼 수 있지만, 허브 추출물의 항산화물질보다 더 우수한지는 미지수이므로 이에 대한 추가연구가 필요하며 항산화 능력이 우수한 아미노산으로 대체하는 방안도 추후 검토해 볼 수 있다고 판단된다.

배합비별 자외선 유도 피부세포 사멸에 대한 효과

허브 추출물로 구성된 H7에 아미노산이 첨가된 HA1, HA2, HA3을 대상으로 피부세포에서의 세포독성과 자외선으로 유도된 피부세포 사멸 조건에서 피부세포 보호 효과를 비교하였다. 우선, 피부세포에서 H7, HA1, HA2, HA3의 농도별 세포독성 여부를 관찰한 결과(Fig. 2), 4가지 시료 모두 12.5~800 μg/mL의 범위에서 세포독성은 관찰되지 않았으며 오히려 HA1과 HA2에서는 시료의 첨가와 함께 세포의 생존이 증가하는 경향을 보였다. HA1의 12.5, 25 μg/mL에서 세포 생존활성이 대조군(CON)에 비해 각각 18.2%, 14.5 % 증가하였으며(Fig. 2B), HA2의 경우 12.5, 25 μg/mL 농도에서 세포 생존활성이 대조군에 비해 34.3%, 23.5% 증가하는 결과를 보였다(Fig. 2C). 이상의 결과는 허브 추출물 배합 H7과 아미노산이 첨가된 배합 HA1, HA2, HA3이 피부세포에 대해 독성이 없음을 말해주며, 자외선으로 유도된 세포 사멸 조건에서 H7, HA1, HA2, HA3 배합 시료들의 세포 보호 효과를 추가로 측정하였다. 자외선 조사로 인한 피부세포의 생존활성(viability)은 정상군(NOR)에 비해 50% 정도 감소하여 세포 사멸이 유도되었다(CON)(Fig. 3). 이러한 자외선 조사 조건에서 배합 시료를 처리한 결과 H7, HA1, HA2, HA3 시료 모두 처리 농도가 증가할수록 자외선에 의한 세포 사멸을 억제하는 효과를 보였다. 400 μg/mL의 농도를 기준으로 비교하면 H7은 세포 생존활성이 대조군에 비해 33.9% 증가하였으며, HA1과 HA2는 대조군에 비해 각각 28.1%, 28.5% 증가하였고, HA3은 대조군에 비해 세포 생존활성이 50.9% 증가하여 가장 높은 생존력을 나타내었다(Fig. 3A~D). 이러한 결과는 800 μg/mL의 농도에서도 비슷하게 나타났다. 또한 H7과 HA(1~3) 간의 유의적인 차이를 보기 위해 400 μg/mL와 800 μg/mL 2가지 농도에서 세포 보호 효과를 비교하였다(Fig. 3E). 800 μg/mL의 농도를 기준으로 비교하면 HA3의 세포 생존활성이 H7, HA1, HA2와 비교하여 각각 14.6%, 19.7%, 16.1%만큼 더 증가하여 다른 배합비들(H7, HA1, HA2)에 비해 유의적으로 우수한 것으로 관찰되었다(P<0.05). 따라서 자외선으로 유도된 피부세포의 사멸 억제 활성은 HA3이 가장 우수하게 나타났다. 아미노산이 첨가된 배합 시료 간의 비교에서는 아르기닌이 상대적으로 많은 배합비일수록, ABTS 소거 활성이 높을수록 세포 보호 효과가 높았다(Fig. 3B~D). 하지만 허브 추출물로만 구성된 H7과 아미노산이 첨가된 HA3의 비교에서 H7이 HA1~HA3보다 우수한 ABTS 소거 활성 및 FRAP 환원능을 보였다(Table 4, Fig. 1). 그럼에도 불구하고 자외선 유도 세포 사멸 억제 효과에서는 아미노산이 첨가된 HA3이 좀 더 우수하게 나타났다(Fig. 3E).

Fig. 2. Effects of H7 (A), HA1 (B), HA2 (C), and HA3 (D), on HaCaT cell viability. Cell viability was determined using MTT assay. NOR, normal group (no treatment of samples). All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.
Fig. 3. Effects of H7, HA1, HA2, and HA3 on the viability of UVB-exposed HaCaT cells. HaCaT cells were exposed to UVB (30 mJ/cm2) for 30 s after samples [H7 (A), HA1 (B), HA2 (C), HA3 (D)] was treated for 2 h. Cell viability was examined using MTT assay. The effect of each samples on the viability of UVB-exposed cells was compared at 400 μg/mL and 800 μg/mL (E). NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). H7 400, H7 400 μg/mL; H7 800, H7 800 μg/mL; HA1 400, HA1 400 μg/mL; HA1 800, HA1 800 μg/mL; HA2 400, HA2 400 μg/mL; HA2 800, HA2 800 μg/mL; HA3 400, HA3 400 μg/mL; HA3 800, HA3 800 μg/mL. All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.

이러한 결과는 글루탐산과 아르기닌의 피부세포에 대한 작용과 연관이 있는 것으로 사료된다. 특히 아르기닌은 피부 상처의 회복에 중요한 아미노산으로 알려져 있다. 아르기닌은 세포 내에서 대사되어 산화질소(nitric oxide), 프롤린, 폴리아민으로 전환되며, 이들은 피부세포의 손상과 상처 회복에 중요하게 작용하는 것으로 보고되었다(Gould 등, 2008). 상처가 발생할 때 피부세포 내 낮은 농도의 아르기닌은 상처 회복의 중요 물질인 산화질소의 생성을 제한함으로써 상처 회복을 더디게 한다고 보고되었다(Shi 등, 2000). 글루탐산은 아미노산이면서 신경전달물질의 역할을 하는 것으로 알려져 있으며, 피부 표피세포의 증식을 증가시키고 손상된 피부에 작용하여 피부장벽의 회복을 촉진하는 것으로 보고되었다(Jara 등, 2021). 본 연구에서는 글루탐산에 비해 아르기닌의 피부세포 보호 작용이 조금 더 뛰어난 것으로 사료되며, 글루탐산은 주로 피부세포의 증식에 기여하고 아르기닌은 주로 세포손상 억제에 기여하는 것으로 사료된다(Curran 등, 2006). 또한, 스타아니스 추출물, 생강 추출물, 적포도 추출물, 헤마토코쿠스 추출물 등에 있는 항산화물질도 자외선에 의한 피부세포의 사멸 억제에 기여할 수 있다. 자외선에 의한 세포 사멸은 주로 산화스트레스에 의한 작용이 주를 이룬다(Garg 등, 2020). 자외선에 의한 감광반응은 일중항 산소, 과산화수소, 히드록시라디칼 등의 활성산소를 생산하여 이들이 세포 내 산화-환원 시스템의 균형을 깨뜨리며 산화스트레스를 유발하는 것으로 알려져 있다(Garg 등, 2020). 이러한 과도한 산화스트레스는 세포의 구성 분자들을 변성시키며 세포의 기능을 약화함으로써 세포 사멸을 유도하는 것으로 알려져 있다(Garg 등, 2020). 따라서 HA3에 함유된 항산화물질이 이러한 자외선에 의해서 유도되는 라디칼 생성 및 산화스트레스를 감소시킴으로써 세포 사멸의 억제에 기여하는 것으로 사료된다. HA1, HA2, HA3 모두 동일한 종류의 성분으로 구성되어 있지만 배합되는 아미노산의 비율에서 차이가 나며 아르기닌과 글루탐산이 3:1의 비율로 배합되는 HA3이 좀 더 우수한 효과를 나타내는 것으로 보인다. ABTS 라디칼 소거 활성의 IC50값에서도 HA1, HA2, HA3이 각각 8.58 μg/mL, 7.62 μg/mL, 3.65 μg/mL를 보여 HA3이 상대적으로 우수한 배합비임을 보여주었다. 이상의 결과를 토대로 자외선으로 유도된 피부세포의 광노화에 대한 바이오마커 분석은 HA3 시료를 중심으로 진행하였다.

보습인자의 발현에 대한 배합비 HA3의 효과

HA3을 대상으로 피부세포에서 보습인자 관련 바이오마커의 발현에 미치는 영향에 대해서 분석하였다. 대표적인 피부 보습인자인 콜라겐(collagen-1)과 히알루론산 합성효소(HAS)는 자외선 조사 시 mRNA 발현량이 정상군에 비해 각각 24.8%, 27.3% 감소하였다(Fig. 4). 이는 자외선 조사로 피부세포 내 콜라겐과 히알루론산 생성이 약화되었음을 말해준다. HA3을 처리한 군에서는 농도 의존적으로 콜라겐과 히알루론산 합성효소의 발현량이 유의적으로 증가하였다. 콜라겐의 mRNA 수준은 HA3의 100, 200, 400 μg/mL의 농도에서 대조군에 비해 각각 32.2%, 51.7%, 58.6%로 증가하였다(Fig. 4A). 히알루론산 합성효소의 유전자 발현량 또한 HA3의 100, 200, 400 μg/mL의 농도에서 대조군에 비해 42.2%, 69.7%, 76.8% 증가하였다(Fig. 4B). HA3의 200, 400 μg/mL의 농도에서는 정상범위보다 오히려 콜라겐과 히알루론산의 발현량이 증가하는 것으로 나타나는데, 이는 자외선 손상에 대한 보상반응과 콜라겐과 히알루론산의 생성 촉진 활성이 함께 나타나는 것으로 보인다. 반면 히알루론산을 분해하는 효소인 히알루론산 분해효소(HYAL)의 유전자 발현은 자외선 조사 시 정상군에 비해 3.1배(207.7%) 이상 증가하였고 HA3을 처리한 군에서는 농도 의존적으로 그 발현량이 감소하였다(Fig. 4C), HA3 100, 200, 400 μg/mL의 농도에서 HYAL 발현량이 대조군에 비해 각각 12.4%, 35.9%, 57.4% 감소하였다. 이상의 결과는 HA3을 처리할 때 피부세포가 자외선에 의해 손상되는 환경에서 보습인자인 콜라겐과 히알루론산의 파괴를 방어하고 이러한 보습인자를 분해하는 효소를 억제할 수 있음을 보여준다. 이러한 HA3의 보습인자에 대한 생성 촉진 효과는 아르기닌을 비롯한 아미노산과 항산화 성분들에서 기인하는 것으로 보이며, 특히 아르기닌의 피부세포로의 유입은 arginase 경로를 통해 ornithine, 프롤린을 생성함으로써 콜라겐 생성에 기여하는 것으로 보고되었고(Curran 등, 2006), 아르기닌을 투여한 랫트 피부의 콜라겐 생성과 elasticity가 증가하는 것이 보고되었다(de Souza 등, 2017). 또한 글루탐산은 콜라겐 생성에 필요한 프롤린과 dihyroxyproline의 전구물질로 알려져 있으며(Ishibashi 등, 1968), 아미노산들의 조합이 콜라겐 생성에 중요하게 작용하는 것으로 보인다. Murakami 등(2012)은 branched-chain amino acids, 아르기닌, glutamine, 프롤린의 조합이 개별적인 아미노산보다 콜라겐 생성률을 더 많이 증가시킴을 보였다. 피부 보습과 관련하여 본 연구에서 사용된 허브류에 관한 직접적인 연구는 드물지만 알로에베라 추출물과 적포도 추출물은 피부의 수분을 유지하면서 여드름, 상처나 종기 등의 피부트러블을 완화하는 용도의 가능성을 보인 연구들(Hekmatpou 등, 2019; Ndiaye 등, 2011)이 있으며, 적포도의 레스베라트롤은 피부 케어 제품인 hydrogel의 성분으로써 가능성을 보였다(Ndiaye 등, 2011). 콜라겐은 피부에서 가장 풍부한 단백질로 피부를 지탱해 주는 역할을 하며 주변 섬유들과의 네트워크를 형성하여 피부에 강도와 탄력성을 부여한다(Al-Atif, 2022; Reilly와 Lozano, 2021). 또한, 피부의 상처 회복 및 조직의 재생을 돕는 기능을 하지만, 나이가 듦에 따라 그 수준이 감소하여 주름형성에 기여한다(Al-Atif, 2022; Reilly와 Lozano, 2021). 히알루론산은 수분과의 결합능력이 뛰어나 피부의 대표적인 보습인자로 알려져 있으며, 피부뿐만 아니라 관절과 연결조직 등에서 윤활제 역할을 하여 관절건강과 유연성에 기여한다(Papakonstantinou 등, 2012). 특히, 히알루론산은 콜라겐의 생성을 자극하여 피부를 건강하게 유지하는 역할을 하는 것으로 알려져 있다(Papakonstantinou 등, 2012). 콜라겐과 히알루론산은 나이가 듦에 따라 노화현상으로 자연적으로 감소하지만, 자외선의 과도한 노출은 피부 내 이들 보습인자를 분해하는 히알루론산 분해효소를 활성화해 보습인자의 분해를 촉진하며 피부의 조기 노화를 유발한다(Reilly와 Lozano, 2021). 본 실험 결과는 HA3이 피부세포에서 자외선 노출에 의한 보습인자들의 감소를 효과적으로 억제하며 피부 보습인자를 증가시키는 것으로 관찰되었다.

Fig. 4. Effect of HA3 on mRNA expression of skin hydration factors. mRNA levels of collagen-1 (A), HAS (B), and HYAL (C) were examined using real-time PCR. NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). All values represent mean±SD. Means of bars not followed by the same letter (a-e) are significantly different at P<0.05.

기질 분해효소의 발현에 대한 배합비 HA3의 효과

Matrix metalloproteinase(MMPs)는 콜라겐을 비롯한 피부 내 기질을 분해하는 효소이다(Pittayapruek 등, 2016). 자외선 노출 환경에서 MMP-1과 MMP-2의 mRNA 발현에 대한 HA3의 영향을 분석한 결과, 자외선 조사 시 MMP-1과 MMP-2의 발현은 유의적으로 증가하여 정상군에 비해 각각 3.2배, 2.4배 증가하였다(Fig. 5). HA3을 처리함에 따라 이러한 자외선 유도 MMPs의 발현 증가가 유의적으로 감소하였다. HA3 100, 200, 400 μg/mL 처리 시 MMP-1의 발현이 자외선 조사군(CON)에 비해 각각 28.3%, 54.6%, 56.5% 감소하였고, MMP-2의 발현량도 HA3 100, 200, 400 μg/mL 처리 시 각각 29.0%, 35.2%, 41.8% 감소하였다. 따라서 HA3이 자외선 조사로 인한 피부세포 손상 시 피부 기질을 분해하는 MMPs의 발현을 감소시킴으로써 피부세포의 손상을 방어하는 것으로 보인다. 이러한 결과는 HA3에 의한 콜라겐 유전자 발현의 증가(Fig. 4A)와도 일맥상통하였다. MMPs는 콜라겐과 엘라스틴 등의 피부 기질을 구성하는 성분들의 분해를 담당하는 효소로 조직의 리모델링, 상처치료, 염증반응 등 피부의 생리적 현상과 밀접한 관련이 있다(Pittayapruek 등, 2016). 보통 노화된 피부 내 콜라겐의 분해를 촉진함으로써 새로운 콜라겐의 형성에 기여하기도 하며 상처치료 시 활성화되어 조직 재생을 촉진하는 것으로 알려져 있다(Freitas-Rodríguez 등, 2017; Pittayapruek 등, 2016). 또한, 염증반응에서 활성화되어 면역세포의 이동과 활성을 이끄는 것으로 알려져 있다(Freitas-Rodríguez 등, 2017; Pittayapruek 등, 2016). 따라서 MMPs 발현의 피부 내 정상적인 조절은 건강한 피부 생리에 있어서 매우 중요하다. 하지만 자외선 노출과 노화와 같은 피부 환경의 변화는 MMPs의 정상적인 조절작용을 깨뜨리며 과도한 MMPs의 발현은 기질의 분해를 가속화하고 염증반응을 유도하여 피부의 병증을 유발하는 데 크게 기여하는 것으로 알려져 있다(Pittayapruek 등, 2016). MMPs의 발현은 inhibitors of metalloproteinase(TIMP)에 의해서 제어되어 MMPs의 과도한 발현으로 인한 피부 기질의 과도한 분해를 방지한다(Yokose 등, 2012). 본 연구에서도 TIMPs의 발현에 대한 HA3의 영향을 조사하였다(Fig. 5C, D). 자외선은 TIMP-1과 TIMP-2의 mRNA 발현을 각각 2.7배, 2.3배 증가시켰다. 하지만 HA3은 자외선에 의해 증가한 TIMPs의 유전자 발현을 유의적으로 감소시켰다. HA3 100, 200, 400 μg/mL 농도에서 TIMP-1의 발현은 대조군에 비해 각각 29.7%, 55.7%, 59.4% 감소하였으며, TIMP-2의 발현은 각각 15.5%, 32.6%, 52.5%만큼 감소하였다. 이러한 결과는 MMPs와의 관계를 생각해 볼 때 예상과 다른 결과로 보이지만, 이는 자외선에 의해서 MMPs의 발현이 크게 증가할 때 그에 대한 상쇄 작용으로 MMPs의 증가를 억제하기 위해 TIMPs도 함께 상승하는 것으로 사료되며, HA3의 처리가 증가함에 따라 TIMPs의 발현 증가의 필요성이 상대적으로 감소하기 때문에 TIMPs의 발현도 HA3의 처리와 함께 감소하는 것으로 해석된다.

Fig. 5. Effect of HA3 on mRNA expression of MMP¬1, MMP¬2, TIMP¬1, and TIMP¬2. mRNA levels of MMP¬1 (A), MMP¬2 (B), TIMP¬1 (C), and TIMP¬2 (D) were examined using real-time PCR. NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.

피부장벽 인자 발현에 대한 HA3의 효과

피부장벽을 구성하는 핵심단백질인 filaggrin, loricrin, involucrin의 유전자 발현에 대해 자외선 조사 환경에서 HA3의 효과를 분석하였다(Fig. 6).

Fig. 6. Effect of HA3 on RNA expression of filaggrin, loricrin, and involucrin. mRNA levels of filaggrin (A), loricrin (B), and involucrin (C) were examined using real-time PCR. NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.

3개의 피부장벽 단백질 모두 자외선 조사 시 그 발현량이 유의적으로 감소하였다. Filaggrin, loricrin, involucrin의 mRNA 수준은 자외선 조사에 의해 각각 12.2%, 18.2%, 12.3% 감소하였다. HA3을 처리하였을 때 위의 3가지 피부장벽 단백질의 유전자 발현은 농도 의존적으로 증가하였다. Filaggrin은 HA3의 100, 200, 400 μg/mL 농도에서 대조군에 비해 각각 31.6%, 34.6%, 53.3% 증가하였고(Fig. 6A), loricrin은 각각 27.9%, 29.2%, 38.5% 증가하였으며(Fig. 6B), involucrin의 유전자 발현은 각각 20.0%, 26.5%, 50.5% 증가하였다(Fig. 6C). 이러한 결과는 HA3이 자외선 조사로 인해 손상될 수 있는 피부세포의 장벽 인자인 filaggrin, loricrin, involucrin 등의 유전자 발현을 증가시켜 피부세포 손상에 대한 방어 효과가 있음을 보여준다. Filaggrin은 피부 표피의 각질층의 형성에 중요한 단백질로 케라틴 섬유와 결합하여 피부장벽을 형성함으로써 외부로부터 피부를 보호하는 것은 물론 피부의 과도한 수분 손실을 방지한다(Armengot-Carbo 등, 2015). Loricrin 또한 피부각질층에 있는 주요 단백질 중의 하나로 피부장벽의 기계적인 강도를 부여하며 또 다른 피부장벽의 보호기능을 하는 involucrin과 교차결합을 통해 피부장벽의 견고한 구조를 강화함으로써 외부 병원체의 침입과 수분 손실을 방지하는 것으로 알려져 있다(Furue, 2020; Nithya 등, 2015). 최근 한 연구에서는 개박하(Nepeta cataria) 추출물이 피부장벽 인자인 filaggrin과 involucrin 발현을 촉진하는 것으로 보고하였으며(Kim, 2020), 호장근(Reynoutria japonica), 적하수오(Reynoutria multiflora) 등 생약재의 주요 약리 활성 성분인 emodin도 filaggrin, loricrin, involucrin의 발현량을 유의적으로 증가시킴을 보였다(Kim 등, 2021). Razia 등(2021)은 알로에베라꽃 추출물과 그의 활성 성분인 isoorientin이 involucrin의 발현을 증가시킴으로써 피부 보습 효과에 기여한다고 보고하였고, 또 다른 연구에서는 N-acetyl-L-hydroxyproline이라고 하는 아미노산 유도체가 피부의 lamellar 구조를 유지함으로써 피부장벽 기능을 강화한다는 결과를 보고하였다(Ohnari 등, 2021). 하지만 아직 HA3의 성분과 피부장벽 인자들에 대한 직접적인 관계에 관한 연구는 미비한 실정이다. 따라서 피부장벽 인자를 강화하는 HA3의 주요성분을 추후 연구에서 분석할 필요가 있을 것으로 사료된다.

본 연구에서는 허브 추출물과 아미노산의 혼합비율을 달리하여 항산화 활성을 측정하였고 피부 표피세포에서 자외선에 의해 유도되는 광노화에 대한 억제 활성을 검토하였다. 허브 추출물의 7가지 조성 중 생강 추출물과 스타아니스 추출물이 주된 성분으로 구성된 배합(H7)이 ABTS 소거 활성 및 FRAP 환원 활성에서 가장 우수하였고, 이어서 아미노산인 아르기닌과 글루탐산이 50%를 차지하는 비율로 첨가되어 얻은 배합(HA1, HA2, HA3)을 대상으로 피부세포 모델에서 자외선 유도 광노화에 대한 효과를 측정하였다. 허브 추출물 배합인 H7과 아미노산(아르기닌:글루탐산=3:1)이 혼합된 조성물(HA3)이 자외선에 의한 피부 표피세포의 세포독성을 가장 크게 억제하였다. HA3은 세포 내 콜라겐과 히알루론산의 mRNA 수준을 유의적으로 증가시켰으며 히알루론산을 분해하는 효소인 히알루론산 분해효소와 기질 분해효소인 MMP-1/2의 유전자 발현을 유의적으로 감소시켰다. 더 나아가 HA3은 피부장벽 인자로 알려진 filaggrin, loricrin, involucrin의 mRNA 발현을 유의적으로 증가시켰다. 이상의 결과에 근거하면 HA3은 자외선에 의해서 유도되는 광노화를 효과적으로 억제하여 피부세포를 보호하는 것으로 관찰되었다. 따라서 본 연구는 피부 보호 작용을 하는 기능성식품의 개발을 위한 조성물로써 허브 추출물과 아미노산(아르기닌, 글루탐산)의 최적 혼합비를 설정하는데 기초자료를 제공한다.

  1. Al-Atif H. Collagen supplements for aging and wrinkles: A paradigm shift in the field of dermatology and cosmetics. Dermatol Pract Concept. 2022. 12:e2022018. https://doi.org/10.5826/dpc.1201a18.
    Pubmed KoreaMed CrossRef
  2. Albaugh VL, Mukherjee K, Barbul A. Proline precursors and collagen synthesis: Biochemical challenges of nutrient supplementation and wound healing. J Nutr. 2017. 147:2011-2017.
    Pubmed KoreaMed CrossRef
  3. Armengot-Carbo M, Hernández-Martín Á, Torrelo A. The role of filaggrin in the skin barrier and disease development. Actas Dermosifiliogr. 2015. 106:86-95.
    CrossRef
  4. Benzie IFF, Strain JJ. Ferric reducing/antioxidant power assay: Direct measure of total antioxidant activity of biological fluids and modified version for simultaneous measurement of total antioxidant power and ascorbic acid concentration. Methods Enzymol. 1999. 299:15-27.
    Pubmed CrossRef
  5. Beom SH, Kwon HJ, Hyun JA, et al. Analysis of antioxidant activity and total phenol content and flavonoid content through the synergistic effect of Rosa multiflora extracts and ascorbic acid. J Soc Cosmet Sci Korea. 2021. 47:333-340.
  6. Chen CY, Cheng KC, Chang AY, et al. 10-Shogaol, an antioxidant from Zingiber officinale for skin cell proliferation and migration enhancer. Int J Mol Sci. 2012. 13:1762-1777.
    Pubmed KoreaMed CrossRef
  7. Chou HY, Ma DL, Leung CH, et al. Purified astaxanthin from Haematococcus pluvialis promotes tissue regeneration by reducing oxidative stress and the secretion of collagen in vitro and in vivo. Oxid Med Cell Longevity:Article ID 4946902. https://doi.org/10.1155/2020/4946902.
    Pubmed KoreaMed CrossRef
  8. Curran JN, Winter DC, Bouchier-Hayes D. Biological fate and clinical implications of arginine metabolism in tissue healing. Wound Repair Regen. 2006. 14:376-386.
    Pubmed CrossRef
  9. de Jager TL, Cockrell AE, Du Plessis SS. Advances in Experimental Medicine and Biology. Springer. 2017. p 15-23.
    Pubmed CrossRef
  10. de Souza ÁPD, de Oliveira MMR, de Andrade RR, et al. The in vivo effect of L-arginine on skin elasticity in mice. Braz J Pharm Sci. 2017. 53:e00045. https://doi.org/10.1590/s2175-97902017000300045.
    CrossRef
  11. Domaszewska-Szostek A, Puzianowska-Kuźnicka M, Kuryłowicz A. Flavonoids in skin senescence prevention and treatment. Int J Mol Sci. 2021. 22:6814. https://doi.org/10.3390/ijms22136814.
    Pubmed KoreaMed CrossRef
  12. Esteves LC, Machado CO, Gonçalves LCP, et al. Structural ef- fects on the antioxidant properties of amino acid betaxanthins. Antioxidants. 2022. 11:2259. https://doi.org/10.3390/antiox11112259.
    Pubmed KoreaMed CrossRef
  13. Freitas-Rodríguez S, Folgueras AR, López-Otín C. The role of matrix metalloproteinases in aging: Tissue remodeling and beyond. Biochim Biophys Acta-. Mol Cell Res. 2017. 1864:2015-2025.
    Pubmed CrossRef
  14. Furue M. Regulation of filaggrin, loricrin, and involucrin by IL-4, IL-13, IL-17A, IL-22, AHR, and NRF2: pathogenic implications in atopic dermatitis. Int J Mol Sci. 2020. 21:5382. https://doi.org/10.3390/ijms21155382.
    Pubmed KoreaMed CrossRef
  15. Garg C, Sharma H, Garg M. Skin photo-protection with phytochemicals against photo-oxidative stress, photo-carcinogenesis, signal transduction pathways and extracellular matrix remodeling-An overview. Ageing Res Rev. 2020. 62:101127. https://doi.org/10.1016/j.arr.2020.101127.
    Pubmed CrossRef
  16. Gould A, Naidoo C, Candy GP. Arginine metabolism and wound healing. Wound Healing Southern Africa. 2008. 1:48-50.
  17. Hekmatpou D, Mehrabi F, Rahzani K, et al. The effect of aloe vera clinical trials on prevention and healing of skin wound: A systematic review. Iran J Med Sci. 2019. 44:1-9.
  18. Hwang HS, Winkler-Moser JK, Liu SX. Study on antioxidant activity of amino acids at frying temperatures and their interaction with rosemary extract, green tea extract, and ascorbic acid. J Food Sci. 2019. 84:3614-3623.
    Pubmed CrossRef
  19. Ishibashi S, Ide T, Tsurufuji S. Role of glutamic acid as a precursor of collagen proline and hydroxyproline. Biochim Biophys Acta-. Gen Subj. 1968. 165:296-299.
    CrossRef
  20. Jara CP, de Andrade Berti B, Mendes NF. et al. Glutamic acid promotes hair growth in mice. Sci Rep. 2021. 11:15453. https://doi.org/10.1038/s41598-021-94816-y.
    Pubmed KoreaMed CrossRef
  21. Juzeniene A, Moan J. Beneficial effects of UV radiation other than via vitamin D production. Dermatoendocrinol. 2012. 4:109-117.
    Pubmed KoreaMed CrossRef
  22. Kim DJ, Iwasaki A, Chien AL, et al. UVB-mediated DNA damage induces matrix metalloproteinases to promote photoaging in an AhR- and SP1-dependent manner. JCI Insight. 2022. 7:e156344. https://doi.org/10.1172/jci.insight.156344.
    Pubmed KoreaMed CrossRef
  23. Kim HS. Effect of Nepeta cataria extract on the skin barrier function. Korean J Food Preserv. 2020. 27:242-246.
    CrossRef
  24. Kim J, Oh J, Averilla JN, et al. Grape peel extract and resveratrol inhibit wrinkle formation in mice model through activation of Nrf2/HO-1 signaling pathway. J Food Sci. 2019. 84:1600-1608.
    Pubmed CrossRef
  25. Kim SG, Choi JG, Jang YA. Emodin studies on anti-inflammatory and skin barrier improvement activities. JKAST. 2021. 38:1383-1392.
  26. Kim YS, Suh HJ, Park S. Antioxidant activity of hot-water extracts and floral waters from natural plant pigments. Korean J Food Preserv. 2015. 22:129-133.
    CrossRef
  27. Kwon KC, Won JG, Seo JH, et al. Effects of arginine glutamate (RE:pair) on wound healing and skin elasticity improvement after CO2 laser irradiation. J Cosmet Dermatol. 2022. 21:5037-5048.
    Pubmed CrossRef
  28. Kwon YW, Lee SH, Kim AR, et al. Plant callus-derived shikimic acid regenerates human skin through converting human dermal fibroblasts into multipotent skin-derived precursor cells. Stem Cell Res Ther. 2021. 12:346. https://doi.org/10.1186/s13287-021-02409-3.
    Pubmed KoreaMed CrossRef
  29. Lee HS, Seo EY, Kang NE, et al. [6]-Gingerol inhibits metastasis of MDA-MB-231 human breast cancer cells. J Nutr Biochem. 2008. 19:313-319.
    Pubmed CrossRef
  30. Lee J, Park S. Effects of flavonoids on skin according to their structural characteristics: a review. Asian J Beauty Cosmetol. 2022. 20:133-143.
    CrossRef
  31. Li X, Matsumoto T, Takuwa M, et al. Protective effects of astaxanthin supplementation against ultraviolet-induced photoaging in hairless mice. Biomedicines. 2020. 8:18. https://doi.org/10.3390/biomedicines8020018.
    Pubmed KoreaMed CrossRef
  32. Liu Q, Tang GY, Zhao CN, et al. Comparison of antioxidant activities of different grape varieties. Molecules. 2018. 23:2432. https://doi.org/10.3390/molecules23102432.
    Pubmed KoreaMed CrossRef
  33. Majali IS. Antioxidant and anti-inflammatory activity of star anise (Illicium Verum) in murine model. Biomed Pharmacol J. 2022. 15:1097-1108.
    CrossRef
  34. Mashhadi NS, Ghiasvand R, Askari G, et al. Anti-oxidative and anti-inflammatory effects of ginger in health and physical activity: Review of current evidence. Int J Prev Med. 2013. 4(Suppl 1):S36-S42.
  35. Masuko T, Minami A, Iwasaki N, et al. Carbohydrate analysis by a phenol-sulfuric acid method in microplate format. Anal Biochem. 2005. 339:69-72.
    Pubmed CrossRef
  36. McKnight G, Shah J, Hargest R. Physiology of the skin. Surgery (Oxford). 2022. 40:8-12.
    CrossRef
  37. Misawa E, Tanaka M, Saito M, et al. Protective effects of Aloe sterols against UVB-induced photoaging in hairless mice. Photodermatol Photoimmunol Photomed. 2017. 33:101-111.
    Pubmed CrossRef
  38. Murakami H, Shimbo K, Inoue Y, et al. Importance of amino acid composition to improve skin collagen protein synthesis rates in UV-irradiated mice. Amino Acids. 2012. 42:2481-2489.
    Pubmed KoreaMed CrossRef
  39. Mutha RE, Tatiya AU, Surana SJ. Flavonoids as natural phenolic compounds and their role in therapeutics: an overview. Futur J Pharm Sci. 2021. 7:25. https://doi.org/10.1186/s43094-020-00161-8.
    Pubmed KoreaMed CrossRef
  40. Ndiaye M, Philippe C, Mukhtar H, et al. The grape antioxidant resveratrol for skin disorders: Promise, prospects, and challenges. Arch Biochem Biophys. 2011. 508:164-170.
    Pubmed KoreaMed CrossRef
  41. Nithya S, Radhika T, Jeddy N. Loricrin-an overview. J Oral Maxillofac Pathol. 2015. 19:64-68.
    Pubmed KoreaMed CrossRef
  42. Ohnari H, Sekiya M, Naru E, et al. Amino acids and their N-acetylated derivatives maintain the skin's barrier function. Chem Pharm Bull. 2021. 69:652-660.
    Pubmed CrossRef
  43. Papakonstantinou E, Roth M, Karakiulakis G. Hyaluronic acid: A key molecule in skin aging. Dermatoendocrinol. 2012. 4:253-258.
    Pubmed KoreaMed CrossRef
  44. Parrado C, Mercado-Saenz S, et al; Perez-Davo. Environmental stressors on skin aging. Mechanistic insights. Front Pharmacol. 2019. 10:759. https://doi.org/10.3389/fphar.2019.00759.
    Pubmed KoreaMed CrossRef
  45. Pittayapruek P, Meephansan J, Prapapan O, et al. Role of matrix metalloproteinases in photoaging and photocarcinogenesis. Int J Mol Sci. 2016. 17:868. https://doi.org/10.3390/ijms17060868.
    Pubmed KoreaMed CrossRef
  46. Pogorzelska E, Godziszewska J, Brodowska M, et al. Antioxidant potential of Haematococcus pluvialis extract rich in astaxanthin on colour and oxidative stability of raw ground pork meat during refrigerated storage. Meat Sci. 2018. 135:54-61.
    Pubmed CrossRef
  47. Razia S, Park H, Shin E, et al. Effects of aloe vera flower extract and its active constituent isoorientin on skin moisturization via regulating involucrin expression: In vitro and molecular docking studies. Molecules. 2021. 26:2626. https://doi.org/10.3390/molecules26092626.
    Pubmed KoreaMed CrossRef
  48. Reilly DM, Lozano J. Skin collagen through the lifestages: importance for skin health and beauty. Plast Aesthet Res. 2021. 8:2. http://dx.doi.org/10.20517/2347-9264.2020.153.
    CrossRef
  49. Sharafan M, Jafernik K, Ekiert H, et al. Illicium verum (star anise) and trans-anethole as valuable raw materials for medicinal and cosmetic applications. Molecules. 2022. 27:650. https://doi.org/10.3390/molecules27030650.
    Pubmed KoreaMed CrossRef
  50. Shi HP, Efron DT, Most D, et al. Supplemental dietary arginine enhances wound healing in normal but not inducible nitric oxide synthase knockout mice. Surgery. 2000. 128:374-378.
    Pubmed CrossRef
  51. Song Y, Bondad SEC, Tajima H, et al. Grape skin extract prevents UV irradiation induced DNA damage of normal human epidermal keratinocytes cells. J Berry Res. 2020. 10:585-601.
    CrossRef
  52. Stechmiller JK, Childress B, Cowan L. Arginine supplementation and wound healing. Nutr Clin Pract. 2005. 20:52-61.
    Pubmed CrossRef
  53. Sung YY, Kim YS, Kim HK. Illicium verum extract inhibits TNF-α- and IFN-γ-induced expression of chemokines and cytokines in human keratinocytes. J Ethnopharmacol. 2012. 144:182-189.
    Pubmed CrossRef
  54. Suva MA. Evaluation of sun protection factor of Zingiber officinale Roscoe extract by ultraviolet spectroscopy method. J PharmaSciTech. 2014. 3:95-97.
  55. Tanaka M, Yamamoto Y, Misawa E, et al. Effects of aloe sterol supplementation on skin elasticity, hydration, and collagen score: A 12-week double-blind, randomized, controlled trial. Skin Pharmacol Physiol. 2017. 29:309-317.
    Pubmed CrossRef
  56. van den Berg R, Haenen GRMM, van den Berg H, et al. Applicability of an improved Trolox equivalent antioxidant capacity (TEAC) assay for evaluation of antioxidant capacity measurements of mixtures. Food Chem. 1999. 66:511-517.
    CrossRef
  57. Velioglu YS, Mazza G, Gao L, et al. Antioxidant activity and total phenolics in selected fruits, vegetables, and grain products. J Agric Food Chem. 1998. 46:4113-4117.
    CrossRef
  58. Verma A, Zanoletti A, Kareem KY, et al. Skin protection from solar ultraviolet radiation using natural compounds: a review. Environ Chem Lett. 2024. 22:273-295.
    CrossRef
  59. Wong QYA, Chew FT. Defining skin aging and its risk factors: a systematic review and meta-analysis. Sci Rep. 2021. 11:22075. https://doi.org/10.1038/s41598-021-01573-z.
    Pubmed KoreaMed CrossRef
  60. Xu N, Chen G, Liu H. Antioxidative categorization of twenty amino acids based on experimental evaluation. Molecules. 2017. 22:2066. https://doi.org/10.3390/molecules22122066.
    Pubmed KoreaMed CrossRef
  61. Yokose U, Hachiya A, iwiriyanont P Sr, et al. The endogenous protease inhibitor TIMP-1 mediates protection and recovery from cutaneous photodamage. J Invest Dermatol. 2012. 132:2800-2809.
    Pubmed CrossRef
  62. Zhishen J, Mengcheng T, Jianming W. The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals. Food Chem. 1999. 64:555-559.
    CrossRef

Article

Article

Journal of the Korean Society of Food Science and Nutrition 2024; 53(6): 545-557

Published online June 30, 2024 https://doi.org/10.3746/jkfn.2024.53.6.545

Copyright © The Korean Society of Food Science and Nutrition.

허브 추출물-아미노산 혼합물의 자외선 유도 광노화 억제 활성

유예림1․변하준1․김민하2․강남길2․최현선1

1상명대학교 식품영양학과
2(주)뉴트리원

Received: February 13, 2024; Revised: March 7, 2024; Accepted: March 7, 2024

Inhibitory Effect of Herb Extract-Amino Acid Mixtures on UV-Induced Photoaging in HaCaT Cell

Ye-Lim You1 , Ha-Jun Byun1, Minha Kim2, Namgil Kang2, and Hyeon-Son Choi1

1Department of Food Nutrition, Sangmyung University
2Nutrione Co., Ltd.

Correspondence to:Hyeon-Son Choi, Department of Food Nutrition, Sangmyung University, 20, Hongjimun 2-gil, Jongno-gu, Seoul 03016, Korea, E-mail: hsc1970@smu.ac.kr

Received: February 13, 2024; Revised: March 7, 2024; Accepted: March 7, 2024

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

This study examined the optimal ratio of herb extract to amino acids, effectively protecting skin cells from UVB-induced photoaging. The response surface methodology program suggested seven mixture ratios of herb extracts, including ginger and star anise extracts. Among them, the H7 mixture showed the highest antioxidant activity. Arginine and glutamate were added to H7, producing HA1, HA2, and HA3 mixtures to determine their effects on UV-induced photoaging. The HA3 mixture had the highest protective effect against UV-induced cell death. HA3 significantly increased the mRNA expression of collagen 1, hyaluronic acid, and matrix metalloproteinase (1/2) while reducing the activity of hyaluronic acid lyase. HA3 significantly increased the expression of skin barrier genes, including filaggrin, loricrin, and involucrin. Overall, the HA3 mixture effectively protects skin cells from UV-induced photodamage. This study suggested an optimized herb extract/amino acid mixture ratio for developing skin-protective functional foods.

Keywords: photoaging, HaCaT cell, herb extract, glutamic acid, arginine

서 론

피부는 병원체, 화학적 독소, 기계적 스트레스 등 다양한 유해한 환경 자극으로부터 신체를 보호하는 외부 장벽으로서 표피와 진피를 포함하는 여러 층으로 구성되어 있다(McKnight 등, 2022). 피부는 또한 체내 수분과 온도를 조절 및 보존하여 항상성을 유지함은 물론, 체내 물질교환과 감각을 전달하는 기능을 함으로써 육체의 건강뿐만 아니라 웰빙에 기여하는 중요한 역할을 한다(McKnight 등, 2022). 피부의 노화는 피부를 구성하는 세포들의 회복 능력의 저하 등 복잡한 생물학적 과정이 진행되는 현상으로 외부환경과 개인의 생물학적인 특성에 따라 영향을 받는다(Wong과 Chew, 2021). 피부 노화는 보통 시간 흐름에 따라 발생하는 노화인 내인성 노화와 자외선 노출이 주요 원인으로 작용하는 외인성 노화로 분류되며 특히, 외인성 노화는 광노화로 불린다(Domaszewska-Szostek 등, 2021; Parrado 등, 2019). 내인성 노화는 면역기능 억제, 표피 항상성 불균형, 호르몬 변화, 연령 증가, 스트레스 또는 개인의 유전적인 요인에 의해서 발생하며, 대개 세포 수가 감소함에 따라 탄력이 감소하고 수분 손실로 인하여 각질층 구조가 변하는 미세한 주름, 피하지방층 감소 등의 임상적인 특징을 가지지만 비교적 경미하다(Domaszewska-Szostek 등, 2021). 반면 외인성 노화는 햇볕, 대기오염, 흡연 등 환경의 영향을 받으며 특히 자외선의 자극으로 인하여 활성산소종(reactive oxygen species)이 증가하고 산화스트레스가 유발됨으로써 발생한다(Wong과 Chew, 2021). 자외선은 파장이 짧은 비이온화 방사선(100~400 nm)으로 자외선이 가지고 있는 에너지와 반응 특성을 이용하여 의학, 산업, 미용의 용도로 사용되어 왔다(Juzeniene과 Moan, 2012). 햇빛에 의한 UV의 적절한 노출은 체내 비타민 D 생성 등 인체의 건강에 유익한 작용을 할 수 있지만, 과도한 햇빛을 통한 자외선 노출이 증가하면 피부 건강에 해로운 결과를 초래한다. 피부의 주름형성 증가, 탄력 상실, 피부의 두께 증가 등의 미용적인 면에서부터 피부암에 이르기까지 광범위한 위험이 내포되어 있다. 이러한 과도한 자외선 노출은 현재 환경문제로 대두되는 오존층 파괴로 인해 더 심화되고 있다(Verma 등, 2024).

자외선에 의한 피부세포 내 산화스트레스 증가는 염증 및 기질 분해와 관련된 여러 전사인자를 활성화함으로써 염증성 사이토카인을 증가시키고 기질 단백질을 분해하는 효소를 증가시키거나 합성하는 효소를 억제함으로써 피부 내 콜라겐, 히알루론산, 엘라스틴과 같은 건강한 피부를 유지하는 데 필수적인 성분을 감소시킨다(de Jager 등, 2017). 피부에서 가장 흔하게 발견되는 콜라겐은 피부의 구조적 지지력과 탄력성을 제공하고 새로운 세포가 성장하고 재생될 수 있는 복잡한 섬유조직 네트워크를 형성하는 큰 역할을 한다(Al-Atif, 2022).

피부의 장력과 강도, 탄력을 유지하며 피부 보호 역할을 하는 기질 단백질은 자외선 노출에 의한 광노화와 함께 감소하며 굵고 깊은 주름의 발생이 이어진다. 또한, 피부가 건조해지고 탄력성이 감소하는 증상을 나타내고 피부 건조, 색소 침착, 말초혈관 확장 등의 임상적 특징을 나타낸다(Al-Atif, 2022; Kim 등, 2022). 따라서 피부를 자외선 빛으로부터 차단하는 여러 상업용 제품이 상용화되어 왔으며 피부에 바르는 용도로서의 재료뿐만 아니라 식용의 천연재료를 사용하여 자외선에 의한 광노화를 억제하고 이너뷰티를 표방하는 방법이 꾸준히 연구되고 있다(Verma 등, 2024).

일부 식물 또는 허브 추출물은 활성산소를 제거하고 피부 내 기질을 분해하는 효소를 억제하며, 콜라겐의 합성을 촉진하는 역할을 통해 건강한 피부세포를 유지하는 데 기여하는 것으로 알려진다(Chen 등, 2012; Kwon 등, 2021; Li 등, 2020). 또한, 일부 아미노산들은 피부의 섬유아세포 증식을 촉진하거나 콜라겐 합성에 원료로 이용되어 피부의 상처치료를 돕는 등 피부에 긍정적인 영향을 끼치는 것으로 보고되었다(Albaugh 등, 2017; Stechmiller 등, 2005). 특히, Kwon 등(2022)은 아르기닌과 글루탐산의 이온쌍이 레이저 노출에 의한 피부세포의 손상을 막고 세포 내 콜라겐 생성을 촉진할 수 있다고 보고하였다. 따라서 본 연구에서는 항산화 활성에 기반하여 피부주름, 노화의 방지 및 건강한 피부세포를 유지하는 데 도움을 주는 것으로 보고된 허브류 중 식품산업에서 상용되고 있는 다섯 가지(적포도, 스타아니스, 생강, 헤마토코쿠스, 알로에베라) 허브들(Chen 등, 2012; Kim 등, 2019; Kwon 등, 2021; Li 등, 2020; Tanaka 등, 2017)과 피부 손상 및 상처를 복구하고 피부세포의 증식과 콜라겐 생성을 촉진하는 것으로 알려진 아미노산으로 아르기닌과 글루탐산(Albaugh 등, 2017; Stechmiller 등, 2005)의 혼합물에 대해 광노화를 유도한 세포주에서 광노화 억제 활성을 평가하고 최적의 허브-아미노산 배합 비율을 선정하여 피부미용 소재로의 활용 가능성을 제시하고자 한다.

재료 및 방법

실험재료

본 실험에 사용한 5종류의 허브 추출물(헤마토코쿠스 추출물, 알로에베라 추출물, 적포도 추출물, 생강 추출물, 스타아니스 추출물)과 아미노산(아르기닌, 글루탐산)은 (주)뉴트리원으로부터 제공받았다. 각 시료 분말의 정보는 다음과 같다. 적포도(Vitis vinifera) 추출물(적포도 농축 분말 31%, 덱스트린 64.4%, 검류아라비아검 4.6%), 스타아니스(Illicium verum) 추출물(스타아니스 분말 100%), 생강(Zingiber officinale) 추출물(생강 분말 100%), 헤마토코쿠스(Haematococcus pluvialis) 추출물(헤마토코쿠스 추출 분말 100%), 알로에베라(Aloe vera) 추출물(알로에베라 겔 건조 분말 50%, 덱스트린 50%), 글루탐산(L-글루탐산 100%), 아르기닌(L-아르기닌 100%)이 본 연구에 사용되었다.

허브 추출물 및 아미노산 배합비

5종류 허브 추출물의 최적 배합비를 도출하기 위해 response surface methodology를 이용하였으며 배합비 경우의 수는 Supplementary Table 1과 같다. 37개의 배합비 중 5개 허브 추출물을 모두 포함하는 배합(Table 1, H1~H7)을 대상으로 실험에 이용하였다. 이 중 항산화 활성이 가장 우수한 배합비를 선정하고 아미노산인 아르기닌과 글루탐산을 전체 배합 50%의 비중으로 1:3, 1:1, 3:1의 비율로 배합하여 피부세포실험에 이용하였다. 시료들은 농도별로 ddH2O 또는 dimethyl sulfoxide(DMSO)에 용해한 후 실험에 이용하였다.

Table 1 . Mixture ratio of herb extracts by RSM.

RunHaematococcusAloe veraRed grapeGingerStar anise
H10.600.100.100.100.10
H20.100.600.100.100.10
H30.100.100.600.100.10
H40.100.100.100.600.10
H50.100.100.100.100.60
H60.200.200.200.200.20
H70.050.050.300.300.30

RSM: response surface methodology..



총당 측정

총당은 페놀-황산법을 이용해 정량하였다(Masuko 등, 2005). 표준물질로는 dextrose(Sigma-Aldrich)를 사용하였다. 각 시료를 준비한 뒤 시료 0.2 mL에 5% 페놀 용액 0.2 mL를 넣고 섞어준 후 황산 1.0 mL를 넣고 섞어준 뒤 상온에서 20분 식힌 후 microplate에 200 μL씩 분주하고 microplate reader(INNO-M, LTek)를 이용하여 490 nm에서 흡광도를 측정하였다. Dextrose의 농도별(mg/mL) 평균 흡광도를 그래프로 나타내 표준곡선을 구했고 이를 이용해 각 시료의 총당을 계산하여 mg glucose/g으로 나타내었다. 시료는 0.1 mg/mL 농도로 녹여 사용하였다.

총 폴리페놀 측정

총 폴리페놀 함량은 Folin-Denis의 방법을 응용하여 측정하였다(Velioglu 등, 1998). Gallic acid(Sigma-Aldrich)와 각 시료를 준비한 뒤 시료 0.01 mL에 3차 증류수 0.79 mL를 가하여 섞어준 뒤 20% sodium carbonate solution 0.15 mL를 첨가해 섞어주고 0.9 N Folin-Ciocalteu 0.05 mL를 첨가하고 상온 암실에서 30분간 반응시킨 후 microplate에 200 μL씩 분주하여 microplate reader(INNO-M, LTek)에서 흡광도(750 nm)를 측정하였다. Gallic acid의 평균 흡광도와 mg/mL 농도를 그래프로 나타내 표준곡선을 구하고 각 시료의 총 폴리페놀 함량을 계산하여 mg GAE/g으로 나타내었다. 헤마토코쿠스 추출물, 알로에베라 추출물, 적포도 추출물은 100 mg/mL의 농도로 물에 녹여 사용하였고 생강 추출물, 스타아니스 추출물은 50 mg/mL 농도로 녹여 사용하였다.

총 플라보노이드 측정

Catechin(Sigma-Aldrich)과 각 시료를 준비한 뒤 microplate에 각 시료를 50 μL씩 분주하고 5% NaNO2 30 μL를 분주하여 섞어준 후 암실에서 5분간 반응시켰다. 2% AlCl3 60 μL를 추가로 분주하여 섞은 후 암실에서 6분간 반응시키고, 4% NaOH 100 μL를 넣어 섞고 암실에서 11분간 반응시켰다(Zhishen 등, 1999). 반응이 완료되면 microplate reader(INNO-M, LTek)를 이용하여 510 nm에서 흡광도를 측정하였다. Catechin의 평균 흡광도와 mg/mL 농도를 그래프로 나타내 표준곡선을 구하고 각 시료의 총 플라보노이드 함량을 계산하여 mg CE/g으로 나타내었다. 헤마토코쿠스 추출물, 알로에베라 추출물, 적포도 추출물은 100 mg/mL의 농도로 녹여 사용하였고 생강 추출물, 스타아니스 추출물은 10 mg/mL 농도로 녹여 사용하였다.

ABTS 라디칼 소거 활성 측정

2,2′-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)(ABTS) 시약은 7 mM ABTS(diammonium salt, Sigma-Aldrich)와 2.45 mM 과황산칼륨 용액을 1:1로 희석한 후 암실에서 24시간 보관 후 사용하였다. 시료는 ddH2O에 녹여 사용하였으며 96-well plate에 시료 10 μL 분주 후 ABTS 시약 200 μL를 분주해 혼합하였다. 암실에서 30분간 반응시킨 후 414 nm에서 반응액의 흡광도를 측정하였다(van den Berg 등, 1999). 대조군은 ascorbic acid를 사용하였으며 ascorbic acid의 농도별 평균 흡광도를 그래프로 나타내 표준곡선을 구한 후 각 시료의 ABTS 라디칼 소거 활성을 계산하여 mg ascorbic acid equivalent(AAE)/g으로 나타내었다. 시료는 1 mg/mL 농도로 녹여 사용하였다. 또한, HA1, HA2, HA3의 항산화 활성 비교를 위해 각 시료의 농도별 ABTS 라디칼 소거 활성을 구한 후 IC50(concentration required to inhibit ABTS radical by 50%)값으로 나타내었다. ABTS 라디칼 소거 활성은 반응 용액과 대조군의 흡광도 차이를 백분율로 환산하여 확인하였다.

FRAP 환원 활성 측정

Ferric reducing antioxidant power(FRAP) 시약은 300 mM acetate buffer(pH 3.6), 10 mM TPTZ in 40 mM HCl, 20 mM iron(Ⅲ) chloride hexahydrate(FeCl3・6H2O)를 10:1:1로 희석하여 사용하였으며 시료는 DMSO에 녹여 사용하였다. Microplate에 각 시료를 10 μL씩 분주한 후 FRAP 시약 200 μL를 분주하여 섞어준 후 37°C incubator에서 5분간 반응 후 microplate reader(INNO-M, LTek)를 이용하여 593 nm에서 흡광도를 측정하였다(Benzie와 Strain, 1999). 대조군은 ascorbic acid를 사용하였으며 ascorbic acid의 평균 흡광도와 μg/mL 농도를 그래프로 나타내 표준곡선을 구한 후 각 시료의 FRAP 환원 활성을 계산하여 mg AAE/g으로 나타내었다. 시료는 1 mg/mL 농도로 녹여 사용하였다.

세포 생존율

HaCaT(Amorepacific Co.) 세포를 10% fetal bovine serum과 1% penicillin-streptomycin이 함유된 Dulbecco’s modified Eagle’s medium 배지에서 배양하면서 세포 밀도가 70%가 되면 계대배양을 해주면서 세포를 유지하였다. 피부세포를 1.5×104~1.0×105 cells/well의 밀도로 96-well plate에 분주한 뒤 24시간 동안 배양하고 배합비 등의 시료를 농도별로 처리한 후 다시 24시간 동안 배양하여 세포에 충분히 반응시켰다. 24시간 후 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT) 시약(0.5 mg/mL, Sigma-Aldrich)이 함유된 무혈청 배지로 배지를 교환하고 1시간 동안 37°C에서 정치시킨다. 배지를 제거한 후 DMSO를 각 well에 분주하고 MTT formazan을 용해한 후 550 nm에서 흡광도(Spectra Max M3, Molecular Devices)를 측정하였다.

피부세포의 자외선 조사 및 시료 처리

피부세포를 1.0×105 cells/well의 밀도로 6-well plate에 분주하고 24시간 배양하였다. 이후 시료를 농도별로 배지에 녹여 배지를 교환하면서 처리한 후 2시간 뒤 다시 배지를 제거하고 phosphate-buffered saline(PBS)으로 교환한 후 30~35초간 자외선 조사를 실시하였다(30 mJ/cm2). 이후 PBS를 다시 시료가 포함된 배지로 교환한 후 24시간 동안 배양하였다. 24시간 후 세포를 회수하여 RNA를 추출하였다.

Real-time PCR

회수한 세포로부터 TRIzol 시약(Invitrogen)을 이용하여 제공된 protocol에 따라 total RNA를 추출하였다. 총 RNA를 정량한 후 1 μg에 역전사 효소(reverse transcriptase)가 포함된 Maxime RT PreMix kit(iNtRON Biotechnology)을 이용하여 cDNA를 합성하였다. 합성된 cDNA에 SYBR Green PCR master mix(Applied Biosystem)와 primer(100 ng/mL)를 혼합하여 PCR을 진행하였다. PCR은 AriaMX real-time PCR system(Agilent Technology)을 이용하여 진행하였다. 본 실험에 사용된 primer 리스트는 Table 2에 나타내었다.

Table 2 . Primers used in this study.

Oligo nameStartSequence (5’ to 3’)Accession number
MMP1F
R
ATGAAGCAGCCCAGATGTGAG
TGGTCCACATCTGCTCTTGGCA
NM_001297436.2

MMP2F
R
TGCTACACGGATACCCCAAG
GCAGCATCGATATGCTTCACAG
NM_004530

HAS1F
R
CTGCGATACTGGGTAGCCTTCA
CCAGAACTTCTGGTTGTACCAG
NM_001523.4

HYAL1F
R
GGCCAGGGCTTCCTCAAATA
CTGTGACAGTGGCTGAGTGT
NM_054346414.1

FilaggrinF
R
GCTGAAGGAACTTCTGGAAAAGG
GTTGTGGTCTATATCCAAGTGATC
NM_002016
Collagen 1F
R
GATTCCCTGGACCTAAAGGTGC
AGCCTCTCCATCTTTGCCAGCA
NM_000088

InvolucrinF
R
CTGCCTCAGCCTTACTGTGA
GGAGGAACAGTCTTGAGGAG
NM_002016

LoricrinF
R
GCAACCTCGGGTAGCATCA
GCCGTCCAAATAGATCCCC
NM_002016

MMP-1/2: matrix metalloproteinase 1/2, HAS: hyaluronic acid synthase, HYAL1: hyaluronic acid lyase. F: forward, R: reverse..



통계처리

실험 결과는 평균±표준편차로 나타내었으며, IBM SPSS statistics 27을 이용하여 일원배치 분산분석을 한 후 유의한 차이가 있는 경우 Duncan 법을 이용해 P<0.05 수준에서 차이에 대한 유의성을 검증하였다.

결과 및 고찰

허브 추출물의 총당, 폴리페놀 및 플라보노이드 함량

다섯 종류 허브 추출물의 총당, 총 폴리페놀 및 총 플라보노이드 함량을 측정한 결과 당 함량은 적포도 추출물이 가장 많은 1,494.76 mg glucose/g의 함량을 보였으며 다음으로 생강 추출물(1,038.98 mg glucose/g), 헤마토코쿠스 추출물(890.68 mg glucose/g), 알로에베라 추출물(528.77 mg glucose/g)의 순으로 총당 함량을 보였고 스타아니스 추출물이 318.57 mg glucose/g으로 가장 낮은 함량을 보였다(Table 3). 폴리페놀 함량은 스타아니스 추출물이 30.06 mg GAE/g으로 가장 높게 나왔으며, 생강 추출물이 18.77 mg GAE/g, 헤마토코쿠스 추출물과 적포도 추출물이 1.63 mg GAE/g, 1.59 mg GAE/g의 함량을 보였고 알로에베라 추출물은 폴리페놀이 검출되지 않았다. 플라보노이드의 함량도 폴리페놀 함량과 비슷한 경향을 보여 스타아니스 추출물이 17.18 mg CE/g으로 가장 높았으며 생강 추출물(7.64 mg CE/g)이 뒤를 이었다. 헤마토코쿠스 추출물과 적포도 추출물은 각각 1.12 mg CE/g, 0.34 mg CE/g의 플라보노이드 함량을 보였지만 알로에베라 추출물의 플라보노이드는 검출되지 않았다.

Table 3 . Total sugar and polyphenol content of herb extracts.

Herb extractsTotal sugar (mg glucose/g)Total polyphenol (mg GAE/g)Total flavonoid (mg CE/g)
Haematococcus890.68±8.89c1.63±0.10c1.12±0.00c
Aloe vera528.77±4.71d0.00±0.00d0.00±0.00e
Red grape1,494.76±10.60a1.59±0.38c0.34±0.00d
Ginger1,038.98±15.31b18.77±0.47b7.64±0.21b
Star anis318.57±8.24e30.06±0.10a17.18±0.72a

GAE: gallic acid equivalent, CE: catechin equivalent. Means within a column not followed by the same letter (a-e) are significantly different at P<0.05..



폴리페놀은 구조적으로 2개 이상의 페닐기 그룹에 여러 개의 히드록실기가 결합된 방향성 알콜 물질로 식물에서 주로 색소나 쓴맛을 나타내는 특징이 있다(Lee와 Park, 2022). 플라보노이드는 대표적인 폴리페놀 화합물의 일종으로 2개의 페닐기 프로판 탄소골격과 2개의 벤젠고리 A와 B로 이루어져 있다. 이들이 선형으로 연결된 3개의 탄소 사슬(C6-C3-C6) 구조를 가지며 중심 탄소 사슬에는 닫힌 pyran 고리 C가 형성된다(Mutha 등, 2021). 대체로 이러한 폴리페놀 및 플라보노이드는 식물 내에서 당의 이차대사산물로서 외부 환경으로부터 자신을 보호하는 역할을 하며, 사람을 비롯한 동물의 몸에서도 활성산소를 제어하는 역할을 통해 산화스트레스를 조절하고 여러 질병의 발생 위험을 낮출 수 있는 것으로 보고된다(Kim 등, 2015; Mutha 등, 2021). 특히, 이들 식물 유래 폴리페놀은 피부의 노화 개선 작용을 하는 물질로 알려져 건강기능식품, 화장품 등에 많이 사용된다(Lee와 Park, 2022).

허브 추출물 배합의 항산화 활성

일곱 가지 허브 추출물 배합비(H1~H7)에 대해서 ABTS 라디칼 소거 활성과 FRAP 환원능을 측정하여 비교한 결과는 Table 4에 나타내었다. ABTS 소거 활성은 H7이 30.79 mg AAE/g으로 가장 높은 활성을 나타냈으며 H4 22.37 mg AAE/g, H5 20.83 mg AAE/g 순으로 ABTS 소거 활성이 높았고 H2의 ABTS 소거 활성이 가장 낮은 값(2.64 mg AAE/g)을 나타내었다. FRAP 환원능도 H7이 34.50 mg AAE/g으로 가장 높은 값을 보였으며 H5 19.31 mg AAE/g, H4 15.23 mg AAE/g, H6 10.35 mg AAE/g의 순으로 FRAP 환원능을 보였고 H1이 가장 낮은 4.13 mg AAE/g의 환원능을 나타내었다. 본 실험에 사용된 배합비(H1~H7) 중 H7이 가장 높은 ABTS 소거 활성과 FRAP 환원능을 보임으로써 아미노산 첨가 전 허브 추출물 최적 배합비를 H7로 결정하였다. H7이 항산화 활성이 상대적으로 우수하게 나온 이유는 폴리페놀 함량이 상대적으로 많은 스타아니스 추출물과 생강 추출물이 1:1의 비율로 총배합의 60%를 차지했기 때문으로 사료된다. H4와 H5의 경우 스타아니스 추출물과 생강 추출물이 총배합의 70%를 차지하지만 스타아니스 추출물 또는 생강 추출물 어느 한쪽이 압도적으로 많은 6:1 또는 1:6의 비율로 조성되어 있다. 이는 한 가지의 허브 추출물보다 두 가지 허브 추출물을 혼합함으로써 항산화 활성에 기여하는 폴리페놀이 증가하는 것으로 사료된다(Beom 등, 2021). 스타아니스와

Table 4 . ABTS radical scavenging and FRAP reducing activities of herb mixtures.

Sample No.Antioxidant activity of herb mixture

H1H2H3H4H5H6H7
ABTS (mg AAE/g)3.75±0.42d2.64±0.88d3.12±0.34d22.37±1.14b20.83±0.10b13.03±1.20c30.79±2.52a
FRAP (mg AAE/g)4.13±0.08g6.07±0.08e5.12±0.07f15.23±0.90c19.31±0.10b10.35±0.85d34.50±1.30a

AAE: ascorbic acid equivalent. Means within a row not followed by the same letter (a-g) are significantly different at P<0.05..



생강에 대한 항산화 활성은 여러 연구에서 보고되었다. 스타아니스 메탄올 추출물은 ABTS와 DPPH 라디칼 소거 활성에서 각각 95.10 Trolox mg/g과 77.70 Trolox mg/g의 활성을 보였으며, 이러한 스타아니스의 항산화 활성은 LPS로 유도된 동물의 염증 반응을 효과적으로 억제하는 것으로 보인다(Majali, 2022). 특히, 비타민 C 성분인 아스코빈산과 비슷한 효과를 보이는 것으로 보고되었다(Majali, 2022). 스타아니스의 주된 성분은 trans-anethole로 항산화, 항염증 및 항비만 활성을 나타내는 것으로 알려져 있다(Sharafan 등, 2022). 생강 또한 항산화뿐만 아니라 항암, 항염, 항당뇨 작용 등에 대한 생리활성을 갖는 것으로 알려졌다(Mashhadi 등, 2013). 이러한 생강의 생리활성을 나타내는 주된 성분은 진저롤(gingerol), 쇼가올(shogaol) 등이 보고된다(Mashhadi 등, 2013). 특히, Lee 등(2008)은 생강의 [6]-gingerol이 유방암세포의 전이 작용을 억제하는 것으로 보고하였다. 다른 허브에 대해서도 항산화 활성이 보고되고 있지만(Liu 등, 2018; Pogorzelska 등, 2018), 본 연구에서는 스타아니스 추출물과 생강 추출물의 항산화 활성이 더 높게 나온 것으로 보인다. 또한 허브류의 항산화 활성은 추출용제에 따라서 달라질 수 있는데, 본 실험에서는 추출용제에 대한 정보 없이 이미 제품화된 분말을 제공받아 활성을 분석한 경우로 추후 추출용제에 따른 활성의 차이에 대한 실험을 통해 설명할 수 있을 것이다. 본 연구에서는 다섯 가지 허브 추출물을 다 포함하는 조건에서 실험하였다. 이들 허브류는 피부 건강 및 보호에 관해 많은 연구가 보고되어 있다. 포도 껍질이 인간 피부 표피세포에서 자외선에 의한 DNA 손상을 억제할 수 있으며(Song 등, 2020), 생강 물 추출물과 메탄올 추출물은 자외선을 흡수하는 성질에 기인하여 자외선 차단제로서의 가능성도 제기되었다(Suva, 2014). 헤마토코쿠스 내의 아스타잔틴이 인간 피부세포와 랫트에서 산화스트레스와 염증반응을 억제하고 콜라겐 생성을 촉진하는 것으로 보고되었으며(Chou 등, 2020), 알로에베라 추출물 또한 자외선으로 유도된 마우스의 피부 노화현상을 완화하는 것이 보고되었다(Misawa 등, 2017). Sung 등(2012)은 스타아니스 추출물이 인간 각질형성세포인 HaCaT에서 염증성 사이토카인의 발현을 저해하여 항염증성을 나타낸다고 보고하였다.

아미노산 첨가 배합비별 항산화 활성 및 피부세포 세포 생존율에 대한 효과

항산화 활성을 통해서 선정된 H7과 피부세포의 재생 효과가 보고된 2개의 아미노산(아르기닌과 글루탐산)을 혼합하여 피부세포실험을 위한 배합비를 설정하였고 Table 5에 나타내었다(HA1, HA2, HA3). 우선 H7에 아미노산이 포함된 3가지의 배합비별 항산화 활성을 측정한 결과 아르기닌:글루탐산이 3:1의 비율로 포함된 HA3이 가장 높은 ABTS 소거 활성을 나타내었다(Fig. 1). HA3은 25.04 mg AAE/g으로 HA1의 7.89 mg AAE/g보다 3.2배 이상 높았고 HA2의 13.42 mg AAE/g보다 2배가량 높은 항산화 활성을 보였다. IC50값을 비교한 결과에서도 같은 경향을 보였다(Table 6). 즉 HA3의 IC50값이 3.65 mg/mL로 가장 낮은 값을 보여 활성이 가장 높음을 나타냈고 HA2(7.62 mg/mL), HA1(8.58 mg/mL)의 순으로

Table 5 . Ratio of herb mixture added glutamate and arginine.

RunHaematococcusAloe veraRed grapeGingerStar anisArginineGlutamate
H70.0500.0500.3000.3000.300
HA10.0250.0250.1500.1500.1500.1250.375
HA20.0250.0250.1500.1500.1500.2500.250
HA30.0250.0250.1500.1500.1500.3750.125

Table 6 . ABTS IC50 value of HA1, HA2, and HA3.

SampleABTS IC50

HA1HA2HA3
mg/mL8.58±0.65a7.62±0.35a3.65±0.28b

IC50: concentration required to inhibit ABTS radical by 50%. Means within a row not followed by the same letter (a,b) are significantly different at P<0.05..


Fig 1. ABTS scavenging (A) and FRAP reducing (B) activities of HA1, HA2, and HA3. Each number is a mean of three observations. All values represent mean±SD. Means of bars not followed by the same letter (a-c) are significantly different at P<0.05.

ABTS 소거 활성을 보였다. 따라서 아미노산 2종이 추가된 배합비 중 아르기닌이 상대적으로 많이 함유된 배합비가 상대적으로 높은 항산화 활성을 보였다. 하지만 HA3의 ABTS 소거 활성은 아미노산이 제외된 H7의 ABTS 소거 활성인 30.79 mg AAE/g보다는 낮은 활성을 보였는데, 이는 아미노산을 첨가하면서 스타아니스 추출물과 생강 추출물의 첨가 비율이 감소한 것이 영향을 미쳤을 것으로 사료된다.

그럼에도 불구하고 아미노산 및 아미노산 유도체들의 항산화 능력에 관한 연구가 많이 보고되어 왔다(Esteves 등, 2022; Hwang 등, 2019; Xu 등, 2017). Hwang 등(2019)은 180°C의 온도에서 아미노산의 항산화 활성을 측정하였는데 아르기닌, 시스테인, 리신, 메티오닌, 트립토판의 아미노산들은 5.5 mM의 농도에서 대표적인 항산화제인 tertiary-butylhydroquinone(1.1 mM)의 항산화능보다 훨씬 높았다고 보고하였다. 또한, Xu 등(2017)은 20개 표준아미노산의 항산화 능력을 환원 적정법에 근거하여 비교 분석한 결과 아르기닌, 시스테인, 리신, 히스티딘, 메티오닌, 트립토판, 티로신의 7개 아미노산이 다른 13개의 표준아미노산보다 항산화 활성이 우수하였다고 보고하였다. 본 연구에서는 항산화 활성이 우수한 아미노산으로 아르기닌이 포함되어 있어 배합비들의 항산화 활성에 기여할 수 있다고 볼 수 있지만, 허브 추출물의 항산화물질보다 더 우수한지는 미지수이므로 이에 대한 추가연구가 필요하며 항산화 능력이 우수한 아미노산으로 대체하는 방안도 추후 검토해 볼 수 있다고 판단된다.

배합비별 자외선 유도 피부세포 사멸에 대한 효과

허브 추출물로 구성된 H7에 아미노산이 첨가된 HA1, HA2, HA3을 대상으로 피부세포에서의 세포독성과 자외선으로 유도된 피부세포 사멸 조건에서 피부세포 보호 효과를 비교하였다. 우선, 피부세포에서 H7, HA1, HA2, HA3의 농도별 세포독성 여부를 관찰한 결과(Fig. 2), 4가지 시료 모두 12.5~800 μg/mL의 범위에서 세포독성은 관찰되지 않았으며 오히려 HA1과 HA2에서는 시료의 첨가와 함께 세포의 생존이 증가하는 경향을 보였다. HA1의 12.5, 25 μg/mL에서 세포 생존활성이 대조군(CON)에 비해 각각 18.2%, 14.5 % 증가하였으며(Fig. 2B), HA2의 경우 12.5, 25 μg/mL 농도에서 세포 생존활성이 대조군에 비해 34.3%, 23.5% 증가하는 결과를 보였다(Fig. 2C). 이상의 결과는 허브 추출물 배합 H7과 아미노산이 첨가된 배합 HA1, HA2, HA3이 피부세포에 대해 독성이 없음을 말해주며, 자외선으로 유도된 세포 사멸 조건에서 H7, HA1, HA2, HA3 배합 시료들의 세포 보호 효과를 추가로 측정하였다. 자외선 조사로 인한 피부세포의 생존활성(viability)은 정상군(NOR)에 비해 50% 정도 감소하여 세포 사멸이 유도되었다(CON)(Fig. 3). 이러한 자외선 조사 조건에서 배합 시료를 처리한 결과 H7, HA1, HA2, HA3 시료 모두 처리 농도가 증가할수록 자외선에 의한 세포 사멸을 억제하는 효과를 보였다. 400 μg/mL의 농도를 기준으로 비교하면 H7은 세포 생존활성이 대조군에 비해 33.9% 증가하였으며, HA1과 HA2는 대조군에 비해 각각 28.1%, 28.5% 증가하였고, HA3은 대조군에 비해 세포 생존활성이 50.9% 증가하여 가장 높은 생존력을 나타내었다(Fig. 3A~D). 이러한 결과는 800 μg/mL의 농도에서도 비슷하게 나타났다. 또한 H7과 HA(1~3) 간의 유의적인 차이를 보기 위해 400 μg/mL와 800 μg/mL 2가지 농도에서 세포 보호 효과를 비교하였다(Fig. 3E). 800 μg/mL의 농도를 기준으로 비교하면 HA3의 세포 생존활성이 H7, HA1, HA2와 비교하여 각각 14.6%, 19.7%, 16.1%만큼 더 증가하여 다른 배합비들(H7, HA1, HA2)에 비해 유의적으로 우수한 것으로 관찰되었다(P<0.05). 따라서 자외선으로 유도된 피부세포의 사멸 억제 활성은 HA3이 가장 우수하게 나타났다. 아미노산이 첨가된 배합 시료 간의 비교에서는 아르기닌이 상대적으로 많은 배합비일수록, ABTS 소거 활성이 높을수록 세포 보호 효과가 높았다(Fig. 3B~D). 하지만 허브 추출물로만 구성된 H7과 아미노산이 첨가된 HA3의 비교에서 H7이 HA1~HA3보다 우수한 ABTS 소거 활성 및 FRAP 환원능을 보였다(Table 4, Fig. 1). 그럼에도 불구하고 자외선 유도 세포 사멸 억제 효과에서는 아미노산이 첨가된 HA3이 좀 더 우수하게 나타났다(Fig. 3E).

Fig 2. Effects of H7 (A), HA1 (B), HA2 (C), and HA3 (D), on HaCaT cell viability. Cell viability was determined using MTT assay. NOR, normal group (no treatment of samples). All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.
Fig 3. Effects of H7, HA1, HA2, and HA3 on the viability of UVB-exposed HaCaT cells. HaCaT cells were exposed to UVB (30 mJ/cm2) for 30 s after samples [H7 (A), HA1 (B), HA2 (C), HA3 (D)] was treated for 2 h. Cell viability was examined using MTT assay. The effect of each samples on the viability of UVB-exposed cells was compared at 400 μg/mL and 800 μg/mL (E). NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). H7 400, H7 400 μg/mL; H7 800, H7 800 μg/mL; HA1 400, HA1 400 μg/mL; HA1 800, HA1 800 μg/mL; HA2 400, HA2 400 μg/mL; HA2 800, HA2 800 μg/mL; HA3 400, HA3 400 μg/mL; HA3 800, HA3 800 μg/mL. All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.

이러한 결과는 글루탐산과 아르기닌의 피부세포에 대한 작용과 연관이 있는 것으로 사료된다. 특히 아르기닌은 피부 상처의 회복에 중요한 아미노산으로 알려져 있다. 아르기닌은 세포 내에서 대사되어 산화질소(nitric oxide), 프롤린, 폴리아민으로 전환되며, 이들은 피부세포의 손상과 상처 회복에 중요하게 작용하는 것으로 보고되었다(Gould 등, 2008). 상처가 발생할 때 피부세포 내 낮은 농도의 아르기닌은 상처 회복의 중요 물질인 산화질소의 생성을 제한함으로써 상처 회복을 더디게 한다고 보고되었다(Shi 등, 2000). 글루탐산은 아미노산이면서 신경전달물질의 역할을 하는 것으로 알려져 있으며, 피부 표피세포의 증식을 증가시키고 손상된 피부에 작용하여 피부장벽의 회복을 촉진하는 것으로 보고되었다(Jara 등, 2021). 본 연구에서는 글루탐산에 비해 아르기닌의 피부세포 보호 작용이 조금 더 뛰어난 것으로 사료되며, 글루탐산은 주로 피부세포의 증식에 기여하고 아르기닌은 주로 세포손상 억제에 기여하는 것으로 사료된다(Curran 등, 2006). 또한, 스타아니스 추출물, 생강 추출물, 적포도 추출물, 헤마토코쿠스 추출물 등에 있는 항산화물질도 자외선에 의한 피부세포의 사멸 억제에 기여할 수 있다. 자외선에 의한 세포 사멸은 주로 산화스트레스에 의한 작용이 주를 이룬다(Garg 등, 2020). 자외선에 의한 감광반응은 일중항 산소, 과산화수소, 히드록시라디칼 등의 활성산소를 생산하여 이들이 세포 내 산화-환원 시스템의 균형을 깨뜨리며 산화스트레스를 유발하는 것으로 알려져 있다(Garg 등, 2020). 이러한 과도한 산화스트레스는 세포의 구성 분자들을 변성시키며 세포의 기능을 약화함으로써 세포 사멸을 유도하는 것으로 알려져 있다(Garg 등, 2020). 따라서 HA3에 함유된 항산화물질이 이러한 자외선에 의해서 유도되는 라디칼 생성 및 산화스트레스를 감소시킴으로써 세포 사멸의 억제에 기여하는 것으로 사료된다. HA1, HA2, HA3 모두 동일한 종류의 성분으로 구성되어 있지만 배합되는 아미노산의 비율에서 차이가 나며 아르기닌과 글루탐산이 3:1의 비율로 배합되는 HA3이 좀 더 우수한 효과를 나타내는 것으로 보인다. ABTS 라디칼 소거 활성의 IC50값에서도 HA1, HA2, HA3이 각각 8.58 μg/mL, 7.62 μg/mL, 3.65 μg/mL를 보여 HA3이 상대적으로 우수한 배합비임을 보여주었다. 이상의 결과를 토대로 자외선으로 유도된 피부세포의 광노화에 대한 바이오마커 분석은 HA3 시료를 중심으로 진행하였다.

보습인자의 발현에 대한 배합비 HA3의 효과

HA3을 대상으로 피부세포에서 보습인자 관련 바이오마커의 발현에 미치는 영향에 대해서 분석하였다. 대표적인 피부 보습인자인 콜라겐(collagen-1)과 히알루론산 합성효소(HAS)는 자외선 조사 시 mRNA 발현량이 정상군에 비해 각각 24.8%, 27.3% 감소하였다(Fig. 4). 이는 자외선 조사로 피부세포 내 콜라겐과 히알루론산 생성이 약화되었음을 말해준다. HA3을 처리한 군에서는 농도 의존적으로 콜라겐과 히알루론산 합성효소의 발현량이 유의적으로 증가하였다. 콜라겐의 mRNA 수준은 HA3의 100, 200, 400 μg/mL의 농도에서 대조군에 비해 각각 32.2%, 51.7%, 58.6%로 증가하였다(Fig. 4A). 히알루론산 합성효소의 유전자 발현량 또한 HA3의 100, 200, 400 μg/mL의 농도에서 대조군에 비해 42.2%, 69.7%, 76.8% 증가하였다(Fig. 4B). HA3의 200, 400 μg/mL의 농도에서는 정상범위보다 오히려 콜라겐과 히알루론산의 발현량이 증가하는 것으로 나타나는데, 이는 자외선 손상에 대한 보상반응과 콜라겐과 히알루론산의 생성 촉진 활성이 함께 나타나는 것으로 보인다. 반면 히알루론산을 분해하는 효소인 히알루론산 분해효소(HYAL)의 유전자 발현은 자외선 조사 시 정상군에 비해 3.1배(207.7%) 이상 증가하였고 HA3을 처리한 군에서는 농도 의존적으로 그 발현량이 감소하였다(Fig. 4C), HA3 100, 200, 400 μg/mL의 농도에서 HYAL 발현량이 대조군에 비해 각각 12.4%, 35.9%, 57.4% 감소하였다. 이상의 결과는 HA3을 처리할 때 피부세포가 자외선에 의해 손상되는 환경에서 보습인자인 콜라겐과 히알루론산의 파괴를 방어하고 이러한 보습인자를 분해하는 효소를 억제할 수 있음을 보여준다. 이러한 HA3의 보습인자에 대한 생성 촉진 효과는 아르기닌을 비롯한 아미노산과 항산화 성분들에서 기인하는 것으로 보이며, 특히 아르기닌의 피부세포로의 유입은 arginase 경로를 통해 ornithine, 프롤린을 생성함으로써 콜라겐 생성에 기여하는 것으로 보고되었고(Curran 등, 2006), 아르기닌을 투여한 랫트 피부의 콜라겐 생성과 elasticity가 증가하는 것이 보고되었다(de Souza 등, 2017). 또한 글루탐산은 콜라겐 생성에 필요한 프롤린과 dihyroxyproline의 전구물질로 알려져 있으며(Ishibashi 등, 1968), 아미노산들의 조합이 콜라겐 생성에 중요하게 작용하는 것으로 보인다. Murakami 등(2012)은 branched-chain amino acids, 아르기닌, glutamine, 프롤린의 조합이 개별적인 아미노산보다 콜라겐 생성률을 더 많이 증가시킴을 보였다. 피부 보습과 관련하여 본 연구에서 사용된 허브류에 관한 직접적인 연구는 드물지만 알로에베라 추출물과 적포도 추출물은 피부의 수분을 유지하면서 여드름, 상처나 종기 등의 피부트러블을 완화하는 용도의 가능성을 보인 연구들(Hekmatpou 등, 2019; Ndiaye 등, 2011)이 있으며, 적포도의 레스베라트롤은 피부 케어 제품인 hydrogel의 성분으로써 가능성을 보였다(Ndiaye 등, 2011). 콜라겐은 피부에서 가장 풍부한 단백질로 피부를 지탱해 주는 역할을 하며 주변 섬유들과의 네트워크를 형성하여 피부에 강도와 탄력성을 부여한다(Al-Atif, 2022; Reilly와 Lozano, 2021). 또한, 피부의 상처 회복 및 조직의 재생을 돕는 기능을 하지만, 나이가 듦에 따라 그 수준이 감소하여 주름형성에 기여한다(Al-Atif, 2022; Reilly와 Lozano, 2021). 히알루론산은 수분과의 결합능력이 뛰어나 피부의 대표적인 보습인자로 알려져 있으며, 피부뿐만 아니라 관절과 연결조직 등에서 윤활제 역할을 하여 관절건강과 유연성에 기여한다(Papakonstantinou 등, 2012). 특히, 히알루론산은 콜라겐의 생성을 자극하여 피부를 건강하게 유지하는 역할을 하는 것으로 알려져 있다(Papakonstantinou 등, 2012). 콜라겐과 히알루론산은 나이가 듦에 따라 노화현상으로 자연적으로 감소하지만, 자외선의 과도한 노출은 피부 내 이들 보습인자를 분해하는 히알루론산 분해효소를 활성화해 보습인자의 분해를 촉진하며 피부의 조기 노화를 유발한다(Reilly와 Lozano, 2021). 본 실험 결과는 HA3이 피부세포에서 자외선 노출에 의한 보습인자들의 감소를 효과적으로 억제하며 피부 보습인자를 증가시키는 것으로 관찰되었다.

Fig 4. Effect of HA3 on mRNA expression of skin hydration factors. mRNA levels of collagen-1 (A), HAS (B), and HYAL (C) were examined using real-time PCR. NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). All values represent mean±SD. Means of bars not followed by the same letter (a-e) are significantly different at P<0.05.

기질 분해효소의 발현에 대한 배합비 HA3의 효과

Matrix metalloproteinase(MMPs)는 콜라겐을 비롯한 피부 내 기질을 분해하는 효소이다(Pittayapruek 등, 2016). 자외선 노출 환경에서 MMP-1과 MMP-2의 mRNA 발현에 대한 HA3의 영향을 분석한 결과, 자외선 조사 시 MMP-1과 MMP-2의 발현은 유의적으로 증가하여 정상군에 비해 각각 3.2배, 2.4배 증가하였다(Fig. 5). HA3을 처리함에 따라 이러한 자외선 유도 MMPs의 발현 증가가 유의적으로 감소하였다. HA3 100, 200, 400 μg/mL 처리 시 MMP-1의 발현이 자외선 조사군(CON)에 비해 각각 28.3%, 54.6%, 56.5% 감소하였고, MMP-2의 발현량도 HA3 100, 200, 400 μg/mL 처리 시 각각 29.0%, 35.2%, 41.8% 감소하였다. 따라서 HA3이 자외선 조사로 인한 피부세포 손상 시 피부 기질을 분해하는 MMPs의 발현을 감소시킴으로써 피부세포의 손상을 방어하는 것으로 보인다. 이러한 결과는 HA3에 의한 콜라겐 유전자 발현의 증가(Fig. 4A)와도 일맥상통하였다. MMPs는 콜라겐과 엘라스틴 등의 피부 기질을 구성하는 성분들의 분해를 담당하는 효소로 조직의 리모델링, 상처치료, 염증반응 등 피부의 생리적 현상과 밀접한 관련이 있다(Pittayapruek 등, 2016). 보통 노화된 피부 내 콜라겐의 분해를 촉진함으로써 새로운 콜라겐의 형성에 기여하기도 하며 상처치료 시 활성화되어 조직 재생을 촉진하는 것으로 알려져 있다(Freitas-Rodríguez 등, 2017; Pittayapruek 등, 2016). 또한, 염증반응에서 활성화되어 면역세포의 이동과 활성을 이끄는 것으로 알려져 있다(Freitas-Rodríguez 등, 2017; Pittayapruek 등, 2016). 따라서 MMPs 발현의 피부 내 정상적인 조절은 건강한 피부 생리에 있어서 매우 중요하다. 하지만 자외선 노출과 노화와 같은 피부 환경의 변화는 MMPs의 정상적인 조절작용을 깨뜨리며 과도한 MMPs의 발현은 기질의 분해를 가속화하고 염증반응을 유도하여 피부의 병증을 유발하는 데 크게 기여하는 것으로 알려져 있다(Pittayapruek 등, 2016). MMPs의 발현은 inhibitors of metalloproteinase(TIMP)에 의해서 제어되어 MMPs의 과도한 발현으로 인한 피부 기질의 과도한 분해를 방지한다(Yokose 등, 2012). 본 연구에서도 TIMPs의 발현에 대한 HA3의 영향을 조사하였다(Fig. 5C, D). 자외선은 TIMP-1과 TIMP-2의 mRNA 발현을 각각 2.7배, 2.3배 증가시켰다. 하지만 HA3은 자외선에 의해 증가한 TIMPs의 유전자 발현을 유의적으로 감소시켰다. HA3 100, 200, 400 μg/mL 농도에서 TIMP-1의 발현은 대조군에 비해 각각 29.7%, 55.7%, 59.4% 감소하였으며, TIMP-2의 발현은 각각 15.5%, 32.6%, 52.5%만큼 감소하였다. 이러한 결과는 MMPs와의 관계를 생각해 볼 때 예상과 다른 결과로 보이지만, 이는 자외선에 의해서 MMPs의 발현이 크게 증가할 때 그에 대한 상쇄 작용으로 MMPs의 증가를 억제하기 위해 TIMPs도 함께 상승하는 것으로 사료되며, HA3의 처리가 증가함에 따라 TIMPs의 발현 증가의 필요성이 상대적으로 감소하기 때문에 TIMPs의 발현도 HA3의 처리와 함께 감소하는 것으로 해석된다.

Fig 5. Effect of HA3 on mRNA expression of MMP¬1, MMP¬2, TIMP¬1, and TIMP¬2. mRNA levels of MMP¬1 (A), MMP¬2 (B), TIMP¬1 (C), and TIMP¬2 (D) were examined using real-time PCR. NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.

피부장벽 인자 발현에 대한 HA3의 효과

피부장벽을 구성하는 핵심단백질인 filaggrin, loricrin, involucrin의 유전자 발현에 대해 자외선 조사 환경에서 HA3의 효과를 분석하였다(Fig. 6).

Fig 6. Effect of HA3 on RNA expression of filaggrin, loricrin, and involucrin. mRNA levels of filaggrin (A), loricrin (B), and involucrin (C) were examined using real-time PCR. NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.

3개의 피부장벽 단백질 모두 자외선 조사 시 그 발현량이 유의적으로 감소하였다. Filaggrin, loricrin, involucrin의 mRNA 수준은 자외선 조사에 의해 각각 12.2%, 18.2%, 12.3% 감소하였다. HA3을 처리하였을 때 위의 3가지 피부장벽 단백질의 유전자 발현은 농도 의존적으로 증가하였다. Filaggrin은 HA3의 100, 200, 400 μg/mL 농도에서 대조군에 비해 각각 31.6%, 34.6%, 53.3% 증가하였고(Fig. 6A), loricrin은 각각 27.9%, 29.2%, 38.5% 증가하였으며(Fig. 6B), involucrin의 유전자 발현은 각각 20.0%, 26.5%, 50.5% 증가하였다(Fig. 6C). 이러한 결과는 HA3이 자외선 조사로 인해 손상될 수 있는 피부세포의 장벽 인자인 filaggrin, loricrin, involucrin 등의 유전자 발현을 증가시켜 피부세포 손상에 대한 방어 효과가 있음을 보여준다. Filaggrin은 피부 표피의 각질층의 형성에 중요한 단백질로 케라틴 섬유와 결합하여 피부장벽을 형성함으로써 외부로부터 피부를 보호하는 것은 물론 피부의 과도한 수분 손실을 방지한다(Armengot-Carbo 등, 2015). Loricrin 또한 피부각질층에 있는 주요 단백질 중의 하나로 피부장벽의 기계적인 강도를 부여하며 또 다른 피부장벽의 보호기능을 하는 involucrin과 교차결합을 통해 피부장벽의 견고한 구조를 강화함으로써 외부 병원체의 침입과 수분 손실을 방지하는 것으로 알려져 있다(Furue, 2020; Nithya 등, 2015). 최근 한 연구에서는 개박하(Nepeta cataria) 추출물이 피부장벽 인자인 filaggrin과 involucrin 발현을 촉진하는 것으로 보고하였으며(Kim, 2020), 호장근(Reynoutria japonica), 적하수오(Reynoutria multiflora) 등 생약재의 주요 약리 활성 성분인 emodin도 filaggrin, loricrin, involucrin의 발현량을 유의적으로 증가시킴을 보였다(Kim 등, 2021). Razia 등(2021)은 알로에베라꽃 추출물과 그의 활성 성분인 isoorientin이 involucrin의 발현을 증가시킴으로써 피부 보습 효과에 기여한다고 보고하였고, 또 다른 연구에서는 N-acetyl-L-hydroxyproline이라고 하는 아미노산 유도체가 피부의 lamellar 구조를 유지함으로써 피부장벽 기능을 강화한다는 결과를 보고하였다(Ohnari 등, 2021). 하지만 아직 HA3의 성분과 피부장벽 인자들에 대한 직접적인 관계에 관한 연구는 미비한 실정이다. 따라서 피부장벽 인자를 강화하는 HA3의 주요성분을 추후 연구에서 분석할 필요가 있을 것으로 사료된다.

요 약

본 연구에서는 허브 추출물과 아미노산의 혼합비율을 달리하여 항산화 활성을 측정하였고 피부 표피세포에서 자외선에 의해 유도되는 광노화에 대한 억제 활성을 검토하였다. 허브 추출물의 7가지 조성 중 생강 추출물과 스타아니스 추출물이 주된 성분으로 구성된 배합(H7)이 ABTS 소거 활성 및 FRAP 환원 활성에서 가장 우수하였고, 이어서 아미노산인 아르기닌과 글루탐산이 50%를 차지하는 비율로 첨가되어 얻은 배합(HA1, HA2, HA3)을 대상으로 피부세포 모델에서 자외선 유도 광노화에 대한 효과를 측정하였다. 허브 추출물 배합인 H7과 아미노산(아르기닌:글루탐산=3:1)이 혼합된 조성물(HA3)이 자외선에 의한 피부 표피세포의 세포독성을 가장 크게 억제하였다. HA3은 세포 내 콜라겐과 히알루론산의 mRNA 수준을 유의적으로 증가시켰으며 히알루론산을 분해하는 효소인 히알루론산 분해효소와 기질 분해효소인 MMP-1/2의 유전자 발현을 유의적으로 감소시켰다. 더 나아가 HA3은 피부장벽 인자로 알려진 filaggrin, loricrin, involucrin의 mRNA 발현을 유의적으로 증가시켰다. 이상의 결과에 근거하면 HA3은 자외선에 의해서 유도되는 광노화를 효과적으로 억제하여 피부세포를 보호하는 것으로 관찰되었다. 따라서 본 연구는 피부 보호 작용을 하는 기능성식품의 개발을 위한 조성물로써 허브 추출물과 아미노산(아르기닌, 글루탐산)의 최적 혼합비를 설정하는데 기초자료를 제공한다.

Fig 1.

Fig 1.ABTS scavenging (A) and FRAP reducing (B) activities of HA1, HA2, and HA3. Each number is a mean of three observations. All values represent mean±SD. Means of bars not followed by the same letter (a-c) are significantly different at P<0.05.
Journal of the Korean Society of Food Science and Nutrition 2024; 53: 545-557https://doi.org/10.3746/jkfn.2024.53.6.545

Fig 2.

Fig 2.Effects of H7 (A), HA1 (B), HA2 (C), and HA3 (D), on HaCaT cell viability. Cell viability was determined using MTT assay. NOR, normal group (no treatment of samples). All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.
Journal of the Korean Society of Food Science and Nutrition 2024; 53: 545-557https://doi.org/10.3746/jkfn.2024.53.6.545

Fig 3.

Fig 3.Effects of H7, HA1, HA2, and HA3 on the viability of UVB-exposed HaCaT cells. HaCaT cells were exposed to UVB (30 mJ/cm2) for 30 s after samples [H7 (A), HA1 (B), HA2 (C), HA3 (D)] was treated for 2 h. Cell viability was examined using MTT assay. The effect of each samples on the viability of UVB-exposed cells was compared at 400 μg/mL and 800 μg/mL (E). NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). H7 400, H7 400 μg/mL; H7 800, H7 800 μg/mL; HA1 400, HA1 400 μg/mL; HA1 800, HA1 800 μg/mL; HA2 400, HA2 400 μg/mL; HA2 800, HA2 800 μg/mL; HA3 400, HA3 400 μg/mL; HA3 800, HA3 800 μg/mL. All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.
Journal of the Korean Society of Food Science and Nutrition 2024; 53: 545-557https://doi.org/10.3746/jkfn.2024.53.6.545

Fig 4.

Fig 4.Effect of HA3 on mRNA expression of skin hydration factors. mRNA levels of collagen-1 (A), HAS (B), and HYAL (C) were examined using real-time PCR. NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). All values represent mean±SD. Means of bars not followed by the same letter (a-e) are significantly different at P<0.05.
Journal of the Korean Society of Food Science and Nutrition 2024; 53: 545-557https://doi.org/10.3746/jkfn.2024.53.6.545

Fig 5.

Fig 5.Effect of HA3 on mRNA expression of MMP¬1, MMP¬2, TIMP¬1, and TIMP¬2. mRNA levels of MMP¬1 (A), MMP¬2 (B), TIMP¬1 (C), and TIMP¬2 (D) were examined using real-time PCR. NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.
Journal of the Korean Society of Food Science and Nutrition 2024; 53: 545-557https://doi.org/10.3746/jkfn.2024.53.6.545

Fig 6.

Fig 6.Effect of HA3 on RNA expression of filaggrin, loricrin, and involucrin. mRNA levels of filaggrin (A), loricrin (B), and involucrin (C) were examined using real-time PCR. NOR, normal group (no treatment of UVB and samples); CON, control group (only UVB irradiation). All values represent mean±SD. Means of bars not followed by the same letter (a-d) are significantly different at P<0.05.
Journal of the Korean Society of Food Science and Nutrition 2024; 53: 545-557https://doi.org/10.3746/jkfn.2024.53.6.545

Table 1 . Mixture ratio of herb extracts by RSM.

RunHaematococcusAloe veraRed grapeGingerStar anise
H10.600.100.100.100.10
H20.100.600.100.100.10
H30.100.100.600.100.10
H40.100.100.100.600.10
H50.100.100.100.100.60
H60.200.200.200.200.20
H70.050.050.300.300.30

RSM: response surface methodology..


Table 2 . Primers used in this study.

Oligo nameStartSequence (5’ to 3’)Accession number
MMP1F
R
ATGAAGCAGCCCAGATGTGAG
TGGTCCACATCTGCTCTTGGCA
NM_001297436.2

MMP2F
R
TGCTACACGGATACCCCAAG
GCAGCATCGATATGCTTCACAG
NM_004530

HAS1F
R
CTGCGATACTGGGTAGCCTTCA
CCAGAACTTCTGGTTGTACCAG
NM_001523.4

HYAL1F
R
GGCCAGGGCTTCCTCAAATA
CTGTGACAGTGGCTGAGTGT
NM_054346414.1

FilaggrinF
R
GCTGAAGGAACTTCTGGAAAAGG
GTTGTGGTCTATATCCAAGTGATC
NM_002016
Collagen 1F
R
GATTCCCTGGACCTAAAGGTGC
AGCCTCTCCATCTTTGCCAGCA
NM_000088

InvolucrinF
R
CTGCCTCAGCCTTACTGTGA
GGAGGAACAGTCTTGAGGAG
NM_002016

LoricrinF
R
GCAACCTCGGGTAGCATCA
GCCGTCCAAATAGATCCCC
NM_002016

MMP-1/2: matrix metalloproteinase 1/2, HAS: hyaluronic acid synthase, HYAL1: hyaluronic acid lyase. F: forward, R: reverse..


Table 3 . Total sugar and polyphenol content of herb extracts.

Herb extractsTotal sugar (mg glucose/g)Total polyphenol (mg GAE/g)Total flavonoid (mg CE/g)
Haematococcus890.68±8.89c1.63±0.10c1.12±0.00c
Aloe vera528.77±4.71d0.00±0.00d0.00±0.00e
Red grape1,494.76±10.60a1.59±0.38c0.34±0.00d
Ginger1,038.98±15.31b18.77±0.47b7.64±0.21b
Star anis318.57±8.24e30.06±0.10a17.18±0.72a

GAE: gallic acid equivalent, CE: catechin equivalent. Means within a column not followed by the same letter (a-e) are significantly different at P<0.05..


Table 4 . ABTS radical scavenging and FRAP reducing activities of herb mixtures.

Sample No.Antioxidant activity of herb mixture

H1H2H3H4H5H6H7
ABTS (mg AAE/g)3.75±0.42d2.64±0.88d3.12±0.34d22.37±1.14b20.83±0.10b13.03±1.20c30.79±2.52a
FRAP (mg AAE/g)4.13±0.08g6.07±0.08e5.12±0.07f15.23±0.90c19.31±0.10b10.35±0.85d34.50±1.30a

AAE: ascorbic acid equivalent. Means within a row not followed by the same letter (a-g) are significantly different at P<0.05..


Table 5 . Ratio of herb mixture added glutamate and arginine.

RunHaematococcusAloe veraRed grapeGingerStar anisArginineGlutamate
H70.0500.0500.3000.3000.300
HA10.0250.0250.1500.1500.1500.1250.375
HA20.0250.0250.1500.1500.1500.2500.250
HA30.0250.0250.1500.1500.1500.3750.125

Table 6 . ABTS IC50 value of HA1, HA2, and HA3.

SampleABTS IC50

HA1HA2HA3
mg/mL8.58±0.65a7.62±0.35a3.65±0.28b

IC50: concentration required to inhibit ABTS radical by 50%. Means within a row not followed by the same letter (a,b) are significantly different at P<0.05..


References

  1. Al-Atif H. Collagen supplements for aging and wrinkles: A paradigm shift in the field of dermatology and cosmetics. Dermatol Pract Concept. 2022. 12:e2022018. https://doi.org/10.5826/dpc.1201a18.
    Pubmed KoreaMed CrossRef
  2. Albaugh VL, Mukherjee K, Barbul A. Proline precursors and collagen synthesis: Biochemical challenges of nutrient supplementation and wound healing. J Nutr. 2017. 147:2011-2017.
    Pubmed KoreaMed CrossRef
  3. Armengot-Carbo M, Hernández-Martín Á, Torrelo A. The role of filaggrin in the skin barrier and disease development. Actas Dermosifiliogr. 2015. 106:86-95.
    CrossRef
  4. Benzie IFF, Strain JJ. Ferric reducing/antioxidant power assay: Direct measure of total antioxidant activity of biological fluids and modified version for simultaneous measurement of total antioxidant power and ascorbic acid concentration. Methods Enzymol. 1999. 299:15-27.
    Pubmed CrossRef
  5. Beom SH, Kwon HJ, Hyun JA, et al. Analysis of antioxidant activity and total phenol content and flavonoid content through the synergistic effect of Rosa multiflora extracts and ascorbic acid. J Soc Cosmet Sci Korea. 2021. 47:333-340.
  6. Chen CY, Cheng KC, Chang AY, et al. 10-Shogaol, an antioxidant from Zingiber officinale for skin cell proliferation and migration enhancer. Int J Mol Sci. 2012. 13:1762-1777.
    Pubmed KoreaMed CrossRef
  7. Chou HY, Ma DL, Leung CH, et al. Purified astaxanthin from Haematococcus pluvialis promotes tissue regeneration by reducing oxidative stress and the secretion of collagen in vitro and in vivo. Oxid Med Cell Longevity:Article ID 4946902. https://doi.org/10.1155/2020/4946902.
    Pubmed KoreaMed CrossRef
  8. Curran JN, Winter DC, Bouchier-Hayes D. Biological fate and clinical implications of arginine metabolism in tissue healing. Wound Repair Regen. 2006. 14:376-386.
    Pubmed CrossRef
  9. de Jager TL, Cockrell AE, Du Plessis SS. Advances in Experimental Medicine and Biology. Springer. 2017. p 15-23.
    Pubmed CrossRef
  10. de Souza ÁPD, de Oliveira MMR, de Andrade RR, et al. The in vivo effect of L-arginine on skin elasticity in mice. Braz J Pharm Sci. 2017. 53:e00045. https://doi.org/10.1590/s2175-97902017000300045.
    CrossRef
  11. Domaszewska-Szostek A, Puzianowska-Kuźnicka M, Kuryłowicz A. Flavonoids in skin senescence prevention and treatment. Int J Mol Sci. 2021. 22:6814. https://doi.org/10.3390/ijms22136814.
    Pubmed KoreaMed CrossRef
  12. Esteves LC, Machado CO, Gonçalves LCP, et al. Structural ef- fects on the antioxidant properties of amino acid betaxanthins. Antioxidants. 2022. 11:2259. https://doi.org/10.3390/antiox11112259.
    Pubmed KoreaMed CrossRef
  13. Freitas-Rodríguez S, Folgueras AR, López-Otín C. The role of matrix metalloproteinases in aging: Tissue remodeling and beyond. Biochim Biophys Acta-. Mol Cell Res. 2017. 1864:2015-2025.
    Pubmed CrossRef
  14. Furue M. Regulation of filaggrin, loricrin, and involucrin by IL-4, IL-13, IL-17A, IL-22, AHR, and NRF2: pathogenic implications in atopic dermatitis. Int J Mol Sci. 2020. 21:5382. https://doi.org/10.3390/ijms21155382.
    Pubmed KoreaMed CrossRef
  15. Garg C, Sharma H, Garg M. Skin photo-protection with phytochemicals against photo-oxidative stress, photo-carcinogenesis, signal transduction pathways and extracellular matrix remodeling-An overview. Ageing Res Rev. 2020. 62:101127. https://doi.org/10.1016/j.arr.2020.101127.
    Pubmed CrossRef
  16. Gould A, Naidoo C, Candy GP. Arginine metabolism and wound healing. Wound Healing Southern Africa. 2008. 1:48-50.
  17. Hekmatpou D, Mehrabi F, Rahzani K, et al. The effect of aloe vera clinical trials on prevention and healing of skin wound: A systematic review. Iran J Med Sci. 2019. 44:1-9.
  18. Hwang HS, Winkler-Moser JK, Liu SX. Study on antioxidant activity of amino acids at frying temperatures and their interaction with rosemary extract, green tea extract, and ascorbic acid. J Food Sci. 2019. 84:3614-3623.
    Pubmed CrossRef
  19. Ishibashi S, Ide T, Tsurufuji S. Role of glutamic acid as a precursor of collagen proline and hydroxyproline. Biochim Biophys Acta-. Gen Subj. 1968. 165:296-299.
    CrossRef
  20. Jara CP, de Andrade Berti B, Mendes NF. et al. Glutamic acid promotes hair growth in mice. Sci Rep. 2021. 11:15453. https://doi.org/10.1038/s41598-021-94816-y.
    Pubmed KoreaMed CrossRef
  21. Juzeniene A, Moan J. Beneficial effects of UV radiation other than via vitamin D production. Dermatoendocrinol. 2012. 4:109-117.
    Pubmed KoreaMed CrossRef
  22. Kim DJ, Iwasaki A, Chien AL, et al. UVB-mediated DNA damage induces matrix metalloproteinases to promote photoaging in an AhR- and SP1-dependent manner. JCI Insight. 2022. 7:e156344. https://doi.org/10.1172/jci.insight.156344.
    Pubmed KoreaMed CrossRef
  23. Kim HS. Effect of Nepeta cataria extract on the skin barrier function. Korean J Food Preserv. 2020. 27:242-246.
    CrossRef
  24. Kim J, Oh J, Averilla JN, et al. Grape peel extract and resveratrol inhibit wrinkle formation in mice model through activation of Nrf2/HO-1 signaling pathway. J Food Sci. 2019. 84:1600-1608.
    Pubmed CrossRef
  25. Kim SG, Choi JG, Jang YA. Emodin studies on anti-inflammatory and skin barrier improvement activities. JKAST. 2021. 38:1383-1392.
  26. Kim YS, Suh HJ, Park S. Antioxidant activity of hot-water extracts and floral waters from natural plant pigments. Korean J Food Preserv. 2015. 22:129-133.
    CrossRef
  27. Kwon KC, Won JG, Seo JH, et al. Effects of arginine glutamate (RE:pair) on wound healing and skin elasticity improvement after CO2 laser irradiation. J Cosmet Dermatol. 2022. 21:5037-5048.
    Pubmed CrossRef
  28. Kwon YW, Lee SH, Kim AR, et al. Plant callus-derived shikimic acid regenerates human skin through converting human dermal fibroblasts into multipotent skin-derived precursor cells. Stem Cell Res Ther. 2021. 12:346. https://doi.org/10.1186/s13287-021-02409-3.
    Pubmed KoreaMed CrossRef
  29. Lee HS, Seo EY, Kang NE, et al. [6]-Gingerol inhibits metastasis of MDA-MB-231 human breast cancer cells. J Nutr Biochem. 2008. 19:313-319.
    Pubmed CrossRef
  30. Lee J, Park S. Effects of flavonoids on skin according to their structural characteristics: a review. Asian J Beauty Cosmetol. 2022. 20:133-143.
    CrossRef
  31. Li X, Matsumoto T, Takuwa M, et al. Protective effects of astaxanthin supplementation against ultraviolet-induced photoaging in hairless mice. Biomedicines. 2020. 8:18. https://doi.org/10.3390/biomedicines8020018.
    Pubmed KoreaMed CrossRef
  32. Liu Q, Tang GY, Zhao CN, et al. Comparison of antioxidant activities of different grape varieties. Molecules. 2018. 23:2432. https://doi.org/10.3390/molecules23102432.
    Pubmed KoreaMed CrossRef
  33. Majali IS. Antioxidant and anti-inflammatory activity of star anise (Illicium Verum) in murine model. Biomed Pharmacol J. 2022. 15:1097-1108.
    CrossRef
  34. Mashhadi NS, Ghiasvand R, Askari G, et al. Anti-oxidative and anti-inflammatory effects of ginger in health and physical activity: Review of current evidence. Int J Prev Med. 2013. 4(Suppl 1):S36-S42.
  35. Masuko T, Minami A, Iwasaki N, et al. Carbohydrate analysis by a phenol-sulfuric acid method in microplate format. Anal Biochem. 2005. 339:69-72.
    Pubmed CrossRef
  36. McKnight G, Shah J, Hargest R. Physiology of the skin. Surgery (Oxford). 2022. 40:8-12.
    CrossRef
  37. Misawa E, Tanaka M, Saito M, et al. Protective effects of Aloe sterols against UVB-induced photoaging in hairless mice. Photodermatol Photoimmunol Photomed. 2017. 33:101-111.
    Pubmed CrossRef
  38. Murakami H, Shimbo K, Inoue Y, et al. Importance of amino acid composition to improve skin collagen protein synthesis rates in UV-irradiated mice. Amino Acids. 2012. 42:2481-2489.
    Pubmed KoreaMed CrossRef
  39. Mutha RE, Tatiya AU, Surana SJ. Flavonoids as natural phenolic compounds and their role in therapeutics: an overview. Futur J Pharm Sci. 2021. 7:25. https://doi.org/10.1186/s43094-020-00161-8.
    Pubmed KoreaMed CrossRef
  40. Ndiaye M, Philippe C, Mukhtar H, et al. The grape antioxidant resveratrol for skin disorders: Promise, prospects, and challenges. Arch Biochem Biophys. 2011. 508:164-170.
    Pubmed KoreaMed CrossRef
  41. Nithya S, Radhika T, Jeddy N. Loricrin-an overview. J Oral Maxillofac Pathol. 2015. 19:64-68.
    Pubmed KoreaMed CrossRef
  42. Ohnari H, Sekiya M, Naru E, et al. Amino acids and their N-acetylated derivatives maintain the skin's barrier function. Chem Pharm Bull. 2021. 69:652-660.
    Pubmed CrossRef
  43. Papakonstantinou E, Roth M, Karakiulakis G. Hyaluronic acid: A key molecule in skin aging. Dermatoendocrinol. 2012. 4:253-258.
    Pubmed KoreaMed CrossRef
  44. Parrado C, Mercado-Saenz S, et al; Perez-Davo. Environmental stressors on skin aging. Mechanistic insights. Front Pharmacol. 2019. 10:759. https://doi.org/10.3389/fphar.2019.00759.
    Pubmed KoreaMed CrossRef
  45. Pittayapruek P, Meephansan J, Prapapan O, et al. Role of matrix metalloproteinases in photoaging and photocarcinogenesis. Int J Mol Sci. 2016. 17:868. https://doi.org/10.3390/ijms17060868.
    Pubmed KoreaMed CrossRef
  46. Pogorzelska E, Godziszewska J, Brodowska M, et al. Antioxidant potential of Haematococcus pluvialis extract rich in astaxanthin on colour and oxidative stability of raw ground pork meat during refrigerated storage. Meat Sci. 2018. 135:54-61.
    Pubmed CrossRef
  47. Razia S, Park H, Shin E, et al. Effects of aloe vera flower extract and its active constituent isoorientin on skin moisturization via regulating involucrin expression: In vitro and molecular docking studies. Molecules. 2021. 26:2626. https://doi.org/10.3390/molecules26092626.
    Pubmed KoreaMed CrossRef
  48. Reilly DM, Lozano J. Skin collagen through the lifestages: importance for skin health and beauty. Plast Aesthet Res. 2021. 8:2. http://dx.doi.org/10.20517/2347-9264.2020.153.
    CrossRef
  49. Sharafan M, Jafernik K, Ekiert H, et al. Illicium verum (star anise) and trans-anethole as valuable raw materials for medicinal and cosmetic applications. Molecules. 2022. 27:650. https://doi.org/10.3390/molecules27030650.
    Pubmed KoreaMed CrossRef
  50. Shi HP, Efron DT, Most D, et al. Supplemental dietary arginine enhances wound healing in normal but not inducible nitric oxide synthase knockout mice. Surgery. 2000. 128:374-378.
    Pubmed CrossRef
  51. Song Y, Bondad SEC, Tajima H, et al. Grape skin extract prevents UV irradiation induced DNA damage of normal human epidermal keratinocytes cells. J Berry Res. 2020. 10:585-601.
    CrossRef
  52. Stechmiller JK, Childress B, Cowan L. Arginine supplementation and wound healing. Nutr Clin Pract. 2005. 20:52-61.
    Pubmed CrossRef
  53. Sung YY, Kim YS, Kim HK. Illicium verum extract inhibits TNF-α- and IFN-γ-induced expression of chemokines and cytokines in human keratinocytes. J Ethnopharmacol. 2012. 144:182-189.
    Pubmed CrossRef
  54. Suva MA. Evaluation of sun protection factor of Zingiber officinale Roscoe extract by ultraviolet spectroscopy method. J PharmaSciTech. 2014. 3:95-97.
  55. Tanaka M, Yamamoto Y, Misawa E, et al. Effects of aloe sterol supplementation on skin elasticity, hydration, and collagen score: A 12-week double-blind, randomized, controlled trial. Skin Pharmacol Physiol. 2017. 29:309-317.
    Pubmed CrossRef
  56. van den Berg R, Haenen GRMM, van den Berg H, et al. Applicability of an improved Trolox equivalent antioxidant capacity (TEAC) assay for evaluation of antioxidant capacity measurements of mixtures. Food Chem. 1999. 66:511-517.
    CrossRef
  57. Velioglu YS, Mazza G, Gao L, et al. Antioxidant activity and total phenolics in selected fruits, vegetables, and grain products. J Agric Food Chem. 1998. 46:4113-4117.
    CrossRef
  58. Verma A, Zanoletti A, Kareem KY, et al. Skin protection from solar ultraviolet radiation using natural compounds: a review. Environ Chem Lett. 2024. 22:273-295.
    CrossRef
  59. Wong QYA, Chew FT. Defining skin aging and its risk factors: a systematic review and meta-analysis. Sci Rep. 2021. 11:22075. https://doi.org/10.1038/s41598-021-01573-z.
    Pubmed KoreaMed CrossRef
  60. Xu N, Chen G, Liu H. Antioxidative categorization of twenty amino acids based on experimental evaluation. Molecules. 2017. 22:2066. https://doi.org/10.3390/molecules22122066.
    Pubmed KoreaMed CrossRef
  61. Yokose U, Hachiya A, iwiriyanont P Sr, et al. The endogenous protease inhibitor TIMP-1 mediates protection and recovery from cutaneous photodamage. J Invest Dermatol. 2012. 132:2800-2809.
    Pubmed CrossRef
  62. Zhishen J, Mengcheng T, Jianming W. The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals. Food Chem. 1999. 64:555-559.
    CrossRef