검색
검색 팝업 닫기

Ex) Article Title, Author, Keywords

JKFN Journal of the Korean Society of Food Science and Nutrition



Online ISSN 2288-5978

Article

home All Articles View

Article

Split Viewer

Journal of the Korean Society of Food Science and Nutrition 2022; 51(10): 1015-1026

Published online October 31, 2022 https://doi.org/10.3746/jkfn.2022.51.10.1015

Copyright © The Korean Society of Food Science and Nutrition.

Inhibitory Effects of Brassica rapa L. and Raphanus sativus L. on Adipogenesis and Lipogenesis through PI3K/AKT Pathway Regulation in C3H10T1/2 Cells

Hye-Jeong Hwang1,2 , NaYeong Park1, In Guk Hwang1, Hae Ju Kang1, Kyeong Won Bang1, and Kyung-A Hwang1

1Department of Agrofood Resources, National Institute of Agricultural Sciences, RDA
2Department of Food and Biotechnology, Korea University

Correspondence to:Kyung-A Hwang, Department of Agrofood Resources, National Institute of Agricultural Sciences, RDA, 166, Nongsaengmyeong-ro, Iseo-myeon, Wanju-Gun, Jeonbuk 55365, Korea, E-mail: kah366@korea.kr

Received: May 19, 2022; Revised: July 8, 2022; Accepted: July 21, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Radish (Raphanus sativus L.) is a representative root vegetable widely cultivated in Asia and known to have various physiological effects, such as gastric protective, anti-inflammatory, antioxidant, and hemostasis improving effects, and to ameliorate digestive disorders. However, studies on the antiobesity effects of white and red radish are inadequate. Therefore, in this study, the anti-adipogenic and anti-lipogenic effects of Ganghwa (RG) and Jeju (RJ) radishes were investigated in C3H10T1/2 cells. Lipid accumulation inhibition by Oil Red O staining and TG contents confirmed that at 1,000 μg/mL RG and RJ significantly inhibited lipid accumulation and dose-dependently reduced the mRNA and protein levels of major adipogenesis and lipogenesis-related factors. In addition, inhibition of the expression of genes in the PI3K/Akt pathway by RG or RJ markedly increased leptin and adiponectin levels. These results indicate radishes are potential functional materials that inhibit adipocyte differentiation and lipid accumulation.

Keywords: radish extracts, adipogenesis, lipogenesis, antiobesity, functional food

비만은 섭취 에너지 대비 소비량 부족 시 체내 에너지 불균형으로 인해 지방세포의 크기나 수가 증가하는 것을 말한다. 비만 유병률은 전 세계적으로 지속적인 증가세를 보이며, 세계보건기구(World Health Organization; WHO)에 따르면 2025년까지 인구의 30%가 과체중 또는 비만인일 것으로 추정된다(Hwang 등, 2022). 또한, 국내에서도 비만율은 증가하고 있으며 2020년 국민건강영양조사 결과 비만율(BMI 25 이상)은 38.3%에 육박하고 있다(Statistics Korea, 2022). 비만은 고혈압, 당뇨병, 고지혈증 등의 대사질환 유발을 초래하므로 건강 문제로 대두되고 있다. 이로 인해 최근에 항비만 천연물 소재를 탐색하여 건강기능식품 및 의약품을 개발하는 연구가 활발하게 진행되고 있다. 최근 연구들에 따르면 녹차, 강황, 풋사과 추출물 등의 천연물 소재의 지방 축적 억제 효과가 보고되고 있다(Yang 등, 2019).

체내 지방 축적과 지방세포의 형성은 지방 전구세포가 성숙한 지방세포로 분화되는 adipogenesis 과정에서 지방이 과도하게 생성되어 발생하며(Brun과 Spiegelman, 1997), lipogenesis 과정에서 지방 합성 관련 유전자들에 의해 조절된다. Adipogenesis의 전체 과정을 제어하는 대표적인 전사인자로는 peroxisome proliferator activated receptor-γ(PPARγ), CCAAT/enhancer binding proteins(C/EBPα, β) 및 sterol regulatory element binding protein-1c(SREBP-1c)가 있으며, 양성 피드백 메커니즘에 따라 상호 활성화됨으로써 하위 단계인 지방생성 관련 유전자의 발현을 활성화한다(Murugan 등, 2021). 지방합성에 관여하는 주요 유전자로는 adipocyte protein 2(Ap2), fatty acid synthase(Fas), steroyl-CoA desaturase1(Scd1) 등이 알려져 있으며, 지방세포의 분화를 촉진하는 전사인자 및 유전자의 발현을 억제하면 체지방 합성 및 축적이 억제되므로 체지방 감소 효과를 평가하는 주요 지표들로 활용되고 있다. 또한, 지방세포 분화에는 내분비기관도 관여하므로 관련 호르몬을 통해 비만 상태를 판단할 수 있다. 이 중 leptin과 adiponectin은 식욕 조절 호르몬으로 비만 시 leptin 수용체의 민감성이 저하되어 중성지방의 축적으로 인해 leptin 합성이 촉진되고(Kim 등, 2016) 세포의 신진대사 및 지방생성에 관여하는 phosphoinositide 3-kinase(PI3K)/protein kinase B(AKT)/mammalian target of rapamycin(mTOR) 신호전달을 활성화함으로써 지방분화를 촉진한다(Krycer 등, 2010). Adiponectin은 지방분화세포에서 C/EBPα와 PPARγ의 활성화로 발현이 증가하는 것으로 알려져 있다(El-Jack 등, 1999).

무(Raphanus sativus L.)는 국내외에서 널리 재배되는 십자화과(Brassicaceae)에 속하는 대표적인 근채류 중 하나이다. 최근 국내에서 재배되는 무의 생산량은 평년 기준 116만 8천 톤 내외에 달하며(Han, 2021) 다양한 품종들이 재배되고 있는데, 그 종류로는 순무, 조선무, 열무 등이 있다. 이 중 순무는 일반 무와 달리 뿌리가 적자색이며, 국내에서 대표적으로 재배되는 지역 특산무는 강화 순무(Brassica rapa L.)이다. 또한, 파종 및 수확시기에 따라서도 봄무, 여름무, 가을무, 월동무(겨울무)로 구분되는데, 이 중 월동무는 주로 9월 하순 또는 10월 상순에 파종하여 12월부터 다음 해 4월까지 수확된 것을 말하며 제주지역에서의 재배 작형이 꾸준히 증가하고 있다(Oh 등, 2019). 무는 수분과 섬유질을 풍부하게 함유하고 있으며, 비타민 A와 C의 함량이 높아 영양학적 가치가 우수한 농산물이다. 또한 전통적으로 소화작용 촉진, 위 보호, 항염, 항암, 항산화, 지혈작용 등 다양한 효능을 지녔다고 알려져 왔다(Jung 등, 2008). 이러한 생리활성 효과는 무에 풍부하게 함유된 glucosinolate, isothiocyanate, flavonoid, anthocyanin, alkaloid, saponin, phenolic acid 등 다양한 기능성 성분에서 찾아볼 수 있다. 이처럼 무는 기능성 성분에 의해 다양한 생리활성에 대한 연구가 활발히 이루어지고 있지만, 아직 무의 항비만 활성 및 작용기전에 관한 연구와 무의 종류에 따른 효능을 비교한 연구는 부족한 실정이다. 순무는 다른 무에 비해 anthocyanin이 풍부하여 항산화 등 생리활성 효능이 더 높은 것으로 보고되고 있다(Park 등, 1999; Tena 등, 2020). 따라서 본 연구에서는 월동무와 순무의 항비만 효능에 대하여 비교 평가하고, 향후 기능성 식품소재로의 개발을 위한 기초자료로써 활용 및 제공하고자 한다.

재료 및 시약

본 연구에서 사용된 무는 순무(radish of Ganghwa; RG)와 월동무(radish of Jeju; RJ) 두 종류로, 각각 강화도 영농조합법인 영인팜(Ganghwa, Korea)과 제주도 농업회사법인 한스에코팜(Jeju, Korea)에서 10~12월에 수확한 것을 구입하였다. Dexamethasone, 3-isobutyl-1-methylxanthine(IBMX), insulin, troglitazone, dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT), Oil Red O solution, formalin, NP-40, triton X-100, sodium deoxychlolate, Tris-HCl, sodium chloride, EDTA, 3-mercaptoethanol은 Sigma-Aldrich Co.(St. Louis, MO, USA)에서 구입하였고, 세포배양에 사용된 Roswell Park Memorial Institute 1640(RPMI 1640), fetal bovine serum(FBS), penicillin-streptomycin(P/S), phosphate buffered saline(PBS), trypsin은 Gibco(Gaithersburg, MD, USA) 제품을 사용하였다. Triglyceride assay kit(ab65336), mouse adiponectin ELISA kit(ab226900), leptin mouse Simple-step ELISA kit(ab199082)은 Abcam(Cambridge, MA, USA)에서 구입하였고, free glycerol colorimetric assay kit(K630-100)은 BioVision(Milpitas, CA, USA)에서 구입한 것을 실험에 사용하였다.

추출물 제조

무의 이물질은 물로 깨끗이 세척하고 세절하여 60°C에서 24시간 열풍건조(DS-240BC, DooSung Co., Ltd., Gwangju, Korea) 후 분쇄기(M20, IKA, Staufen, Germany)로 분쇄하여 추출물 제조에 사용하였다. 분쇄된 무에 시료 중량의 20배수에 해당하는 70% 에탄올을 넣고 상온에서 24시간 교반(SMHS-6, Daihan Co., Wonju, Korea)하여 추출 후 1차 추출물을 회수하고 남은 잔량의 시료에 1차 추출과 동량의 용매를 넣어 이전과 동일한 조건으로 2차 추출을 진행하였다. 추출물은 여과지(No. 1, Whatman International Ltd., Maidstone, UK)에 여과한 후 감압회전농축기(EYELA CCA-1110, Rikakikai Co., Tokyo, Japan)로 농축하여 동결건조하였다. 동결건조된 시료 추출물은 -20°C 냉동 보관하며 실험에 사용하였다.

세포배양

마우스 유래 지방 간엽줄기세포(mesenchymal cell)인 C3H10T1/2 세포는 한국세포주은행(Seoul, Korea)에서 분양받아 실험에 사용하였다. C3H10T1/2 세포는 10% FBS와 1% P/S를 포함하는 RPMI 1640 배지로 37°C, 5% CO2 배양기(Heraeus BB15, Thermo Fisher, Waltham, MA, US)에서 배양하였다. 배양액은 2일 간격으로 교체하면서 세포 밀도가 80~90% 상태일 때 0.25% trypsin을 이용하여 계대배양하여 실험에 사용하였다. 유지 배양된 C3H10T1/2 세포는 지방분화를 위해 12-well plate에 분주하고 분화유도물질 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone이 포함된 배지(MDI)로 교체해주었다. 그 후 insulin과 troglitazone이 포함된 배지를 2일 간격으로 교체해주었으며, 분화유도 6일차에 순무와 월동무 추출물을 농도별로 처리하였다.

세포독성 측정(MTT)

시료에 대한 세포 내 독성 효과를 확인하기 위해 Lim 등(2014)의 실험방법을 변형한 MTT assay로 세포 생존율을 측정하였다. C3H10T1/2 지방전구세포를 96-well plate에 분주하여 2시간 안정화한 후 순무 및 월동무 추출물을 농도별(200, 500, 1,000 μg/mL)로 처리하여 24시간 배양하였다. 또한, MDI 및 troglitazone으로 6일 동안 지방구를 분화시킨 지방분화세포에 추출물을 농도별로 처리하고 24시간 배양하였다. 배양 완료 후 5 mg/mL의 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide(MTT)를 첨가하여 4시간 재배양하였다. 이후 상등액을 제거하고 DMSO를 각 well에 첨가하여 formazan dye를 용해하여 540 nm에서 흡광도를 측정하였다.

Oil Red O 염색

지방분화가 유도된 C3H10T1/2 세포의 지방 생성 정도는 Zebisch 등(2012)의 방법을 변형하여 Oil Red O(ORO) 염색법으로 측정하였다. C3H10T1/2 세포를 12-well plate에 분주하여 MDI 및 troglitazone으로 지방이 분화된 세포에 시료를 농도별(200, 500, 1,000 μg/mL)로 처리하고 24시간 배양하였다. 배양 완료 후 상등액은 제거하고 PBS로 세척하여 10% formalin(approx. 4% formaldehyde)으로 30분간 고정한 후 증류수와 PBS로 세척하고 증류수와 ORO 염색 시약을 4:6(v/v)으로 희석하여 각 well에 첨가하여 30분 동안 염색시켰다. 지방구(lipid droplet)가 염색되면 염색 시약을 제거하고 세척한 후 분화된 양상을 현미경(Leica DMi8, Leica, Mannheim, Germany)으로 촬영하고 isopropanol에 녹여 520 nm에서 흡광도를 측정하였다.

Triglyceride 및 free glycerol 생성량 측정

C3H10T1/2 세포에 생성된 중성지방 함량과 분해 효능을 확인하기 위하여 triglyceride(TG) assay kit과 free glycerol colorimetric assay kit을 이용하여 제조사 매뉴얼에 따라 TG와 free glycerol 생성량을 측정하였다. 분화된 C3H10T1/2 세포에 농도별(200, 500, 1,000 μg/mL) 시료를 처리하여 24시간 배양 후 세포를 PBS로 세척하고 cell scraper로 회수하였다. 회수한 세포는 원심분리하여 상층액을 제거한 후 TG assay에 사용할 sample은 cell pellet에 5% NP-40 용액을 첨가하여 균질화한 후 4°C, 27,000×g 에서 2분간 원심분리하여 상층액을 assay에 사용하였고, free glycerol assay는 cell pellet에 assay buffer를 첨가하여 균질화한 후 10분간 원심분리한 상층액을 분석에 사용하였다. TG assay와 free glycerol assay는 제조사의 사용법에 따라 수행되었으며, microplate reader를 이용해 570 nm에서 흡광도를 측정하였다. Triglyceride와 free glycerol 함량은 각 표준물질의 검량선을 기준으로 계산하였다.

mRNA 발현량 측정

분화된 C3H10T1/2 세포에 농도별(200, 500, 1,000 μg/mL) 시료 처리 후 배양이 완료된 세포의 total RNA 추출은 RNeasy mini kit(Qiagen, Helden, Germany)을 사용하였으며, 추출된 RNA는 reverse transcription system kit(Promega, Madison, WI, USA)을 이용하여 cDNA를 합성하였다. 실험에 사용된 kit은 제조사의 매뉴얼을 기반으로 사용하였다. 합성한 cDNA는 SYBR Green mix(Gendepot, Barker, TX, USA)를 사용하여 지방세포 분화 인자 C/ebpα, C/ebpβ, Pparγ, Srebp-1c, Ap2, Fas, Sd1Pi3k/Akt/mTOR 신호전달 관련 인자 Irs1, Pi3k, Akt, mTOR의 mRNA 발현 정도를 real-time PCR detection system (CFX96TM, Bio-Rad, Hercules, CA, USA)으로 분석하였다. 모든 실험 결과는 Gapdh를 internal control로 사용하여 보정했으며 실험에 사용된 primer의 염기서열은 Table 1과 같다.

Table 1 . Sequence of primers used for real time PCR

Target genePrimerSequences (5'→3')
C/ebpαForwardGCAAAGCCAAGAAGTCGGTG
ReverseTCACTGGTCAACTCCAGCAC
C/ebpβForwardGAAGACGGTGGACAAGCTGA
ReverseGCTTGAACAAGTTCCGCAGG
PparγForwardGGGGATGTCTCACAATGCCA
ReverseGATGGCCACCTCTTTGCTCT
Srebp-1cForwardGAGCCAAAAGGGTCATCATC
ReverseTAAGCAGTTGGTGGTGCAGG
Ap2ForwardCACCGCAGACGACGACAGGAAG
ReverseGCACCTGCACCAGGGC
FasForwardGAGCCAAAAGGGTCATCATC
ReverseTAAGCAGTTGGTGGTGCAGG
Scd1ForwardCCAACACAATGGCATTCCAG
ReverseTATCCATAGAGATGCGCGGC
Irs1ForwardAAGGCCAGCACCTTACCTCG
ReverseAGCCATGGTGGCCCTGGGCAG
Pi3kForwardGAAGTTGCTCTACCCAGTGTCC
ReverseGATAGCCGTTCTTTTCATTTGG
AktForwardACTCATTCCAGACCCACGAC
ReverseAGCCCGAAGTCCGTTATCTT
mTORForwardTGTGAACGGAACATACGACC
ReverseTTGCTTGCCCATCAGAGTCAG
GapdhForwardGTCAAGGCTGAGAACGGGAA
ReverseAAATGAGCCCCAGCCTTCTC


단백질 발현량 측정

각 시료의 지방합성 억제 효능을 확인하기 위해 지방세포 분화 인자(C/EBPα, C/EBPβ, PPARγ, SREBP-1c)와 지방합성인자(aP2, FAS, SCD1), PI3K/AKT/mTOR 신호전달 인자(IRS1, p-PI3K, p-AKT, p-mTOR)의 단백질 발현량을 western blot으로 측정하였다. 분화된 C3H10T1/2 세포에 시료를 농도별(200, 500, 1,000 μg/mL)로 처리하고 24시간 배양 후 PBS로 세척하여 cell scraper로 회수한 뒤 RIPA buffer(0.5% NP-40, 0.5% TritonX-100, 0.1% sodium deoxycholate, 50 mM Tris-Hcl, 150 mM sodium chloride, 1 mM EDTA)를 이용해 단백질을 분리하였다. 용해한 세포는 40분 동안 ice에 방치 후 4°C, 12,000×g에서 20분간 원심분리하였고, 수득된 단백질의 농도는 BCA 방법으로 정량하였다. 단백질은 4~20% SDS-PAGE gel(Bio-Rad) 상에서 분리되었고 PVDF membrane으로 옮겨 antibody의 비특이적 반응 억제를 위해 5% skim milk에 1시간 동안 반응시켰다. 1차 항체는 4°C에서 overnight 시킨 후 1× TBST로 세척하여 2차 항체를 상온에서 1시간 동안 반응시켰다. 단백질은 ECL(Pierce, Rockford, IL, USA)과 Chemi-doc image(Bio-Rad)를 사용하여 결과를 분석하였다.

Leptin 및 adiponectin 생성량 측정

지방 축적에 관여하는 에너지대사 조절인자인 leptin과 adiponectin의 생성량을 측정하기 위해 ELISA kit을 이용하였다. 지방분화 세포에 시료를 농도별(200, 500, 1,000 μg/mL)로 처리한 후 배양이 완료된 상등액을 취하여 4°C에서 20,000×g에 10분간 원심분리하여 debris를 제거하고 회수한 상등액을 실험에 사용하였다. Leptin과 adiponectin의 생성량 측정은 각 제조사의 사용법에 따라 수행되었으며, microplate reader를 이용하여 450 nm에서 흡광도를 측정하였다. Leptin과 adiponectin의 함량은 각 표준물질의 표준곡선을 이용하여 계산하였다.

통계분석

모든 실험은 3회 이상 실시하여 얻은 결과를 평균±평균오차(mean±SEM)로 나타내어 통계 프로그램 SPSS(20.0.0, IBM Co., Armonk, NY, USA)로 분석하였다. 실험군 간의 유의적 차이는 one-way analysis of variance(ANOVA)로 분석하였으며 P<0.05인 경우 통계적 유의성이 있는 것으로 판단하여 Duncan's multiple range 사후분석을 수행하였다.

무 추출물 처리에 의한 세포독성 평가

월동무와 순무 추출물에 대한 세포독성을 확인하기 위해 지방전구세포와 분화된 지방세포에 각 시료를 농도별로 처리하여 세포 생존율을 평가하였다. 그 결과 지방전구세포에 시료를 농도별(200, 500, 1,000 μg/mL)로 처리했을 때, 순무와 월동무 처리군에서 대조군 대비 각각 100, 97, 89% 그리고 99, 93, 82%의 세포 생존율을 나타내었다(Fig. 1A). 또한, 각 추출물을 분화된 지방세포에 처리한 결과, 순무(103, 104, 103%)와 월동무(103, 102, 103%) 처리군 모두 세포독성이 관찰되지 않았다(Fig. 1B). 십자화과 식물인 적양배추 추출물의 1,000 μg/mL 농도에서 100% 이상의 세포 생존율을 나타내었고(Ha와 Lee, 2014), 브로콜리 추출물의 항염증 효능 평가에서도 1,000 μg/mL까지 세포독성이 없음을 보고하였다(Kim, 2019). 따라서 본 연구에서도 1,000 μg/mL를 최대농도로 설정하여 추후 실험을 진행하였다.

Fig. 1. Effects of RG and RJ extracts on cell viability treatment in (A) preadipocyte and (B) adipocyte C3H10T1/2 cells. The data shown are representative of triplicate experiments. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; ANOVA, analysis of variance.

무 추출물의 지방구 형성 및 지질 축적 억제 효과

순무와 월동무 추출물이 지방세포 내 지방구 축적에 미치는 영향을 확인하기 위하여 지방분화 세포에 ORO 염색을 실시하여 현미경 관찰 및 정량분석을 실시하였다. 분화되지 않은 지방세포에서는 지방구가 형성되지 않았으며, MDI와 troglitazone을 처리하여 분화를 유도한 대조군에서는 많은 수의 지방구가 형성되어 염색된 것을 확인하였다. 이후 순무 및 월동무 추출물의 지방구 축적 억제 효과를 평가하기 위해 지방이 분화된 세포에 각 추출물을 농도별로(200, 500, 1,000 μg/mL) 처리한 후 ORO 염색법을 통해 염색된 지방구를 현미경으로 확인하였다. 그 결과, 순무와 월동무 추출물 모두 MDI 처리 대조군 대비 지방구 축적이 유의적으로 감소한 것을 확인하였다(Fig. 2A). 이후 염색된 지방구를 isopropanol에 용해시켜 흡광도를 측정한 결과, 지방분화 세포군에서 분화가 유도되지 않은 대조군보다 지방구 축적 정도가 48% 높게 나타났고 순무 추출물 처리군은 지방분화 세포군 대비 각 농도에서 약 12% 이상 감소하였으며, 통계적으로 유의한 차이가 있었다(P<0.05). 또한 월동무 추출물 처리 시 지방분화 세포군 대비 20% 이상 감소하였고, 특히 1,000 μg/mL 농도에서는 26%까지 감소시키는 것을 확인하였다(Fig. 2B). Yang 등(2019)의 연구 결과에 따르면 3T3L1 세포에 검정 무 추출물을 처리하였을 때 지방구 형성 및 TG 생성이 감소한다고 보고하였고, 적무 새싹 추출물은 마우스 모델에서 체중 감소와 혈중 TG 함량을 감소시킨다고 보고하였다(Lee 등, 2018b). 십자화과 식물 유래 추출물에서 항비만 효과를 나타낸 것과 같이 순무와 월동무 추출물에서도 지방구 축적이 억제되는 것을 확인하였으므로, 순무와 월동무 추출물도 항비만 소재로서 가능성을 확인하였다.

Fig. 2. Effects of RG and RJ extracts on intracellular lipid accumulation in C3H10T1/2 cells. (A) Oil Red O staining was performed and visualized by microscopy (×200 magnification). (B) Lipid accumulation was evaluated by measuring of absorbance at 540 nm. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.

무 추출물의 triglyceride 및 free glycerol 생성 조절 효과

C3H10T1/2 세포에서 순무와 월동무에 대한 TG 생성 억제 효과를 확인하기 위하여 TG assay를 진행하였다(Fig. 3A). MDI를 처리한 대조군의 TG 함량은 61.8 mM로 분화되지 않은 대조군보다 높은 함량을 보여 지방세포 분화가 적절히 이루어졌음을 확인하였다. 순무 추출물 처리군에서는 TG 함량이 시료의 농도 의존적으로 유의적인 감소 추세를 보였으며, 1,000 μg/mL 농도에서 대조군보다 23% 감소시킨 것을 확인하였다. 월동무 추출물 처리군의 TG 함량은 200, 500, 1,000 μg/mL 농도에서 각각 47.2, 55.8, 58.9%로 농도 의존적으로 감소하는 경향을 보였으며, MDI 처리 대조군 대비 통계적으로 유의한 차이를 나타냈다(P<0.05). 특히 500과 1,000 μg/mL 농도의 월동무 추출물 처리 시 순무 처리군보다 1.2배 이상 낮게 TG가 축적되었다.

Fig. 3. Effects of RG and RJ extracts on triglyceride accumulation and free glycerol release in C3H10T1/2 cells. (A) Triglyceride contents was analyzed by triglyceride quantification assay kit. (B) Free glycerol contents was measured by glycerol assay. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.

지방세포 내 축적된 TG가 분해되면 glycerol과 지방산으로 나누어지므로 free glycerol 함량은 TG의 분해 정도를 간접적으로 나타내는 척도로서 사용된다(Liu 등, 2001). 본 연구에서 C3H10T1/2 세포에서 각 추출물의 triglyceride 분해 촉진 효능을 평가하기 위하여 free glycerol assay를 실시한 결과, 지방전구세포보다 MDI 처리 대조군에서 free glycerol 함량이 46% 낮은 것을 확인하였다(Fig. 3B). 순무와 월동무 추출물 처리군은 농도 의존적으로 free glycerol의 함량이 증가하는 경향을 보였으며, 모든 농도에서 MDI 처리 대조군 대비 1.6배 이상 유의적으로 높은 함량을 나타내었다(P<0.05). 특히, 순무와 월동무 추출물의 최고농도에서 각각 3.2 mM과 3.5 mM로 free glycerol 함량이 유의적으로 높게 나타나 두 추출물 모두 TG 분해 효과가 뛰어남을 확인하였다(P<0.05). Jang 등(2008)은 고콜레스테롤 식이 섭취 흰쥐에 무청 파우더 급여 시 분변 내 콜레스테롤, 중성지방 등의 배설이 증가하였다고 보고하였으며, Lee 등(2009)은 고지방식이로 비만을 유도한 흰쥐에서 브로콜리 새싹 추출물 섭취가 부고환 지방조직 내 중성지방 함량을 유의적으로 저하하였다고 보고하였다. 또한 배추, 무 등을 사용하여 제조한 김치추출물을 3T3-L1 지방세포에 처리 시 지방분화세포군 대비 glycerol의 함량이 증가하였다고 보고하였다(Lee 등, 2015). 선행 연구 결과들과 유사하게 본 연구에서도 순무와 월동무 추출물이 생성된 TG를 지방산과 free glycerol로 분해해 지방 축적을 억제하는 것을 확인할 수 있었다.

무 추출물의 지방세포 분화 관련 인자 유전자 및 단백질 발현 억제 효과

지방전구세포가 지방세포로 분화되는 과정에서 C/EBP family와 PPARγ, SREBP-1c와 같은 전사인자의 영향을 받아 adipogenic factor들의 발현을 유도한다. PPARγ는 이 과정을 총괄적으로 조절하여 지방세포로 분화된 상태를 유지하는 데 필수적인 주요 인자이며(Choi 등, 2013), C/EBPβ는 분화 초기에 발현되어 C/EBPα와 PPARγ 유전자가 발현되도록 유도하여 말기 분화 과정까지 촉진한다(Yang 등, 2019). 또한, SREBP-1c는 insulin의 영향으로 발현되며 PPARγ의 발현에 직접적으로 관여한다(Kim 등, 1998). 이렇게 분화된 지방세포에는 지방구 생성 및 triglyceride 축적과 같은 형태학적 특징과 더불어 aP2, FAS 및 SCD1과 같은 지방세포 특이적인 유전자의 발현으로 지방세포의 특징을 지니게 된다(Ambati 등, 2007).

순무와 월동무 추출물이 adipogenesis에 관여하는 전사인자의 발현에 미치는 영향을 확인하기 위하여 real-time PCR과 western blot을 이용하여 유전자 및 단백질의 발현 정도를 확인하였다(Fig. 4). C3H10T1/2 세포를 분화하여 순무와 월동무 추출물을 처리한 결과, C/ebpα의 mRNA 발현은 농도 의존적으로 유의하게 억제되었으며, C/ebpβ의 mRNA 발현은 모든 농도의 시료 처리군에서 MDI 처리 대조군 대비 유의적으로 감소하는 것을 확인하였다(Fig. 4A). C/EBPα 단백질의 발현량은 무 추출물 처리 시 농도 의존적으로 감소 추세를 보였으며, 월동무 추출물 1,000 μg/mL 처리군에서 단백질 발현이 가장 크게 억제됨을 확인하였다(Fig. 4B). 또한, PPARγ의 유전자와 단백질 발현은 MDI 처리 대조군 대비 시료농도에 따라 감소 추세를 보였으며, 500과 1,000 μg/mL 농도의 순무 추출물과 월동무 추출물 처리군에서 mRNA와 단백질 발현이 유의하게 억제되었다. 지방분화 초기 전사인자들의 억제 효능에 따라 SREBP-1c의 mRNA와 단백질 발현 역시 순무 및 월동무 처리에 의해 MDI 처리 대조군 대비 현저하게 감소하였으며, 월동무 처리군이 순무 처리군보다 발현량이 적게 나타났으나 두 시료 간에 유의한 차이는 없었다. Wang 등(1995)의 보고에 따르면 C/EBPα가 제거된 비만 동물모델에서 지방이 축적되지 않았다. 즉, 비만 억제 및 비만 관련 대사성 질환 예방을 위해서는 C/EBPα 등과 같은 지방세포 분화 전사인자들의 활성 억제가 중요한 부분으로 생각되는데, 본 연구에서 순무와 월동무 추출물이 지방세포 분화 전사인자들의 발현을 억제하는 것을 확인할 수 있었다. 따라서 지방분화 전사인자의 영향에 따라 발현이 조절되는 하위인자인 지방합성 관련 유전자 및 단백질 발현에 순무와 월동무 추출물이 미치는 영향에 대해 평가하였다(Fig. 4). 순무와 월동무 추출물에 의해 PPARγ의 발현이 감소함에 따라 aP2의 mRNA와 단백질 발현량이 MDI 처리 대조군 대비 유의하게 감소하였으며, 특히 월동무 추출물에서 현저하게 발현이 억제된 것을 확인하였다. aP2의 발현 감소는 세포 내 지방 합성의 감소를 유도하여 지방 축적을 억제하는 결과를 가져온다(Evans 등, 2004). 이에 순무와 월동무 추출물 처리에 따른 지방생성 억제 효과는 PPARγ와 aP2의 발현과 크게 관련이 있다고 판단된다. 또한, 지방 합성의 주요 조절인자인 SREBP-1c는 지방세포 분화 초기에 유도되며, 지방산 합성에 관여하는 FasScd1 등의 유전자 발현을 촉진한다(Park 등, 2018). 본 연구에서 순무와 월동무 추출물 처리에 의해 FAS와 SCD1의 mRNA와 단백질 발현이 MDI 처리 대조군 대비 농도 의존적으로 감소하였다. Yang 등(2019)은 검정무 추출물의 지질축적 및 adipogenesis 억제 효과가 전사인자인 C/EBPα, C/EBPδ, PPARγ, SREBP-1c 및 ADD1의 유전자의 발현 억제에 기인한다고 보고하였으며, 유채꽃 추출물도 지질 생성(PPARγ, C/EBPα, SREBP-1c, aP2) 및 합성(ACC, FAS), 지방분해(CPT-1, UCP2, PGC-1α) 인자의 단백질 발현을 조절함으로써 항비만 효능을 나타내는 것으로 확인하였다(Kwon 등, 2021). 이는 본 연구에서 순무와 월동무 추출물이 지방세포 분화 인자의 발현을 억제하는 결과와 유사하였으며, 순무와 월동무의 지방합성 억제 효능은 adipogenesis 중·후기에 발현되는 지방합성 인자들의 발현이 억제됨에 따라 나타나는 것으로 사료된다.

Fig. 4. Effects of RG and RJ on mRNA expression and protein expression in C3H10T1/2 cells. (A) mRNA expression of C/ebpα, C/ebpβ, Pparγ, Srebp-1c, Ap2, Fas, and Scd-1. (B) Protein expression and densitometry analysis of C/EBPα, PPARγ, SREBP-1c, aP2, FAS, and SCD1. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.

무 추출물의 leptin 및 adiponectin 생성 평가

순무와 월동무 추출물 처리에 따른 adipogenesis에 관여하는 호르몬인 leptin과 adiponectin의 생성량을 ELISA kit으로 측정하였다(Fig. 5). Adiponectin은 인슐린 저항성을 개선시켜 체내 지질량을 조절하는 호르몬으로 알려졌지만(Hotta 등, 2000) insulin growth factor binding protein(IGFBP-3), β-adrenergic에 의해 생성량이 감소하기도 한다(Kim, 2011). 또한, 지방세포 분화 시 adiponectin 수용체 증가로 PPARγ 발현이 활성화하고 adiponectin 생성을 유도한다. 따라서 순무와 월동무 처리에 의한 adiponectin의 생성량을 측정한 결과, MDI를 처리한 대조군보다 시료 처리군에서 adiponectin 생성량이 농도 의존적으로 유의하게 감소한 것을 확인하였다(Fig. 5A). 특히 순무와 월동무 추출물의 1,000 μg/mL 처리 시 각각 6.6, 6.2 ng/mL로 adiponectin 생성 감소 효능이 가장 큰 것을 확인하였다. 지방분화 시 분비되는 또 다른 호르몬 leptin은 식욕을 억제하여 에너지 소비를 증가시키고 체내 대사를 조절하는 물질로, 지방세포 내 지방 축적량이 많을수록 그 분비량이 증가한다고 알려져 있으며 혈중 leptin의 농도는 체지방량을 나타내는 지표로 사용되고 있다(Leroy 등, 1996). 분화된 지방세포 배양액에서 leptin의 생성량을 측정한 결과, MDI 처리 대조군(365 pg/mL)에서 지방전구세포군(47 pg/mL) 대비 생성량이 약 7.8배로 현저하게 증가하여 지방분화가 유발된 것을 확인하였다(Fig. 5B). 지방분화가 유발된 세포에 농도 1,000 μg/mL의 순무와 월동무 추출물 처리 시 각각 52 pg/mL, 44 pg/mL로 월동무 추출물은 지방전구세포군과 거의 유사한 수준으로 leptin 함량이 감소하는 것을 확인하였다. 이는 삼채 열수 추출물의 adipogenesis 억제 효과에 관한 이전 연구에서 3T3-L1 세포에 시료 처리 시 최대 40%까지 leptin 농도가 유의적으로 감소했다고 보고한 결과와 유사한 경향을 보였다(Yang 등, 2016). Leptin은 지방 조직에서 생성되는 단백질 호르몬으로 체지방량과 양의 상관관계를 나타내며 체내 저장된 에너지양을 보여주는 지표로 알려져 있다(Chen 등, 2013; Yu 등, 2008). Leptin은 체내 여러 말초 조직뿐만 아니라 중추신경계 전체에 위치한 수용체에 결합한다. 특히 leptin 신호전달을 담당하는 주요 수용체 LepRb에 결합하면 진핵세포의 성장과 신진대사를 조절하고 영양소와 호르몬 신호를 연결하는 PI3K/AKT 신호를 활성화한다(Chen 등, 2013; Kim 등, 2009). 또한, PI3K/AKT 경로의 하위 인자들의 발현이 증가되면 지질 생합성은 촉진하고 지방분해를 억제하고 AKT는 콜레스테롤 및 지방산 축적을 증가시키는 SREBP를 통해 지질 대사를 조절하는 것으로 알려져 있다(Krycer 등, 2010; Hay, 2011). 따라서 본 연구에서 무의 지방세포 분화 및 합성 인자들의 조절 효능에 대한 명확한 작용기전을 구명하기 위해서 무의 PI3K/AKT 경로 인자들의 발현조절 연구가 수행되어야 할 것으로 생각된다.

Fig. 5. Effects of RG and RJ on the production of leptin and adiponectin in the cell culture media. (A) Adiponectin and (B) leptin were measured using ELISA. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; ANOVA, analysis of variance.

무 추출물의 Pi3k/Akt 신호전달 관련 유전자 및 단백질 발현 억제 효과

순무와 월동무 추출물이 지방생성과 관련된 PI3K/AKT 신호전달 인자의 유전자 및 단백질 발현에 미치는 영향을 평가하였다(Fig. 6). 그 결과, 지방전구세포군 대비 MDI 처리 대조군에서 Irs, Pi3k, Akt, mTOR의 유전자 발현량이 증가하였고 순무와 월동무 추출물을 처리함에 따라 지방전구세포군 수준으로 유전자 발현량이 현저하게 감소하는 것을 확인하였다(Fig. 6A). 또한, 지방분화에 의해 PI3K, AKT, mTOR 단백질의 인산화는 순무 및 월동무 처리에 의해 농도 의존적으로 인산화가 억제되어 유전자 발현 수준과 유사한 경향을 나타내는 것을 확인할 수 있었다(Fig. 6B). 이러한 결과는 대추나무 잎 추출물이 PI3K/AKT 신호를 억제하여 지방 합성 인자의 발현을 감소시킨다는 Savova 등(2021)의 연구 결과와 일치하며, 순무와 월동무 추출물의 지방합성 억제는 PI3K/AKT 신호에 의해 조절될 것으로 생각된다.

Fig. 6. Effects of RG and RJ on PI3K/Akt pathway (A) mRNA and (B) protein expression in C3H10T1/2 cells. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.

본 연구에서 순무와 월동무 추출물은 지방구 축적 및 TG 생성 억제, free glycerol 분해 촉진, 지방분화 유전자 및 단백질 발현 억제와 더불어 PI3K/AKT 신호전달 조절을 통한 지방세포 분비 호르몬 adipokine 생성 억제를 통해 비만 개선에 탁월한 효능을 지닌 것으로 확인되었다. 이러한 결과는 십자화과 채소에 많이 함유되어 있고, 항산화, 항암, 항비만 등의 다양한 생리활성 효능을 지닌 glucosinolate 및 isothiocyanate 화합물에 의한 것으로 생각된다(Talalay와 Fahey, 2001; Vicas 등, 2013; Becker와 Juvik, 2016). 십자화과의 기능성에 관한 연구에서 glucosinolate 화합물의 일종인 sinigrin을 지표성분으로 설정하여 많은 연구가 수행되고 있으며(Oh 등, 2015; Wang 등, 2011), 특히 sinigrin이 지방 축적 및 활성산소 감소, 지방 축적, 지방산 산화, 에너지 대사에 관련된 단백질 조절 등을 통해 비만을 개선하는 데 탁월한 효능이 있는 것으로 보고되고 있다(Lee 등, 2018a; Kwon 등, 2021). 따라서 본 연구에서도 무 추출물의 glucosinolate 및 isothiocyanate 화합물, sinigrin 등의 기능성 성분이 항비만 효능에 영향을 주었다고 생각되나, 향후 순무와 월동무에 함유된 주요 기능성 성분에 관한 연구가 이루어져야 할 것으로 생각된다.

본 연구에서는 순무(RG)와 월동무(RJ)의 항비만 효과를 확인하고자 MDI로 분화를 유도한 C3H10T1/2 세포에서 지질 축적 및 지방합성 억제 효과를 평가하였다. 무 추출물을 처리한 지방분화 세포의 지질 축적 정도와 triglyceride 함량을 측정한 결과, 무 추출물에 의해 지방구 형성과 triglyceride 축적을 감소시켰고, 특히 RJ 1,000 μg/mL 처리 시 높은 억제 효과를 보였다. 또한, 지방분화를 통해 지방구 형성(adipogenesis)에 관여하는 전사인자(C/EBPα와 β, PPARγ, SREBP-1c)와 지방합성(lipogenesis)에 관여하는 인자(aP2, FAS, SCD1)의 발현량을 측정한 결과, 시료 처리 농도 의존적으로 유전자와 단백질 발현량이 감소한 것을 확인하였으며, 모든 인자에서 RG 처리군보다 RJ 처리군의 효능이 더욱 우수하였다. 또한, MDI 처리 대조군에서 분비가 증가한 leptin과 adiponectin의 생성량이 무 추출물 처리에 의해 농도 의존적으로 감소하는 결과를 확인하였으며, 이러한 결과는 세포 표면 leptin 수용체에 leptin 결합에 의해 활성화되는 PI3K/AKT 신호 관련 인자들의 유전자 발현이 무 추출물 처리에 의해 억제됨으로써 지방 합성 및 지질 축적을 억제하여 무 추출물이 비만 개선에 효과적임을 밝혀냈다. 이상의 결과로부터 RG와 RJ가 지방세포 분화 기전과 지방분화 호르몬의 생성량을 억제함으로써 지방분화 및 합성 억제 효능이 우수함을 확인하였다. 향후 전임상 효능 평가와 RG와 RJ가 함유한 기능성 성분 연구가 이루어진다면 체지방감소에 도움을 주는 건강기능식품 소재로서의 활용 가능성을 제시할 수 있을 것으로 생각된다.

본 연구는 농촌진흥청 국립농업과학원 농업과학기술 연구개발사업(과제번호: PJ015144012022)의 지원을 받아 연구되었음.

  1. Ambati S, Kim HK, Yang JY, et al. Effects of leptin on apoptosis and adipogenesis in 3T3-L1 adipocytes. Biochem Pharmacol. 2007. 73:378-384.
    Pubmed CrossRef
  2. Becker TM, Juvik JA. The role of glucosinolate hydrolysis products from Brassica vegetable consumption in inducing antioxidant activity and reducing cancer incidence. Diseases. 2016. 4:22. https://doi.org/10.3390/diseases4020022
    Pubmed KoreaMed CrossRef
  3. Brun RP, Spiegelman BM. Obesity and the adipocyte PPARγ and the molecular control of adipogenesis. Differentiation. 1997. 83:813-819.
  4. Chen J, Crawford R, Chen C, et al. The key regulatory roles of the PI3K/Akt signaling pathway in the functionalities of mesenchymal stem cells and applications in tissue regeneration. Tissue Eng Part B Rev. 2013. 19:516-528.
    Pubmed CrossRef
  5. Choi JH, Park YH, Lee IS, et al. Antioxidant activity and inhibitory effect of Aster scaber Thunb. extract on adipocyte differentiation in 3T3-L1 cells. Korean J Food Sci Technol. 2013. 45:356-363.
    CrossRef
  6. El-Jack AK, Hamm JK, Pilch PF, et al. Reconstitution of insulin-sensitive glucose transport in fibroblasts requires expression of both PPARγ and C/EBPα. J Biol Chem. 1999. 274:7946-7951.
    Pubmed CrossRef
  7. Evans RM, Barish GD, Wang YX. PPARs and the complex journey to obesity. Nat Med. 2004. 10:355-361.
    Pubmed CrossRef
  8. Ha HJ, Lee CB. Antioxidant and anti-inflammation activity of red cabbage extract. Korean J Culinary Res. 2014. 20(2):16-26.
    CrossRef
  9. Han ES, Kim DJ, Han BH, et al. Supply and demand trend and outlook of root vegetables. In: Agricultural Outlook 2021 Korea: Changes and Future of Agriculture and Rural Communities after COVID-19. Korea Rural Economic Institute, Naju, Korea. 2021. p 353-411.
  10. Hay N. Interplay between FOXO, TOR, and Akt. Biochim Biophys Acta. 2011. 1813:1965-1970.
    Pubmed KoreaMed CrossRef
  11. Hotta K, Funahashi T, Arita Y, et al. Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol. 2000. 20:1595-1599.
    Pubmed CrossRef
  12. Hwang HJ, Hwang YJ, Kim YJ, et al. Immature sword bean pods (Canavalia gladiata) inhibit adipogenesis in C3H10T1/2 cells and mice with high-fat diet-induced obesity. J Chin Med Assoc. 2022. 85:67-76.
    Pubmed CrossRef
  13. Jang HS, Ahn JM, Ku KH, et al. Effect of radish leaves powder on the gastrointestinal function and fecal triglyceride, and sterol excretion in rats fed a hypercholesterolemic diet. J Korean Soc Food Sci Nutr. 2008. 37:1258-1263.
    CrossRef
  14. Jung UJ, Baek NI, Chung HG, et al. Effects of the ethanol extract of the roots of Brassica rapa on glucose and lipid metabolism in C57BL/KsJ-db/db mice. Clin Nutr. 2008. 27:158-167.
    Pubmed CrossRef
  15. Kim HK. The anti-inflammatory effects of heat-treated broccoli extract. The Journal of Convergence on Culture Technology. 2019. 5:397-404.
  16. Kim HS. The effect of IGFBP-3 on adipokines and gene expression in differentiated 3T3-L1 adipocytes. J Korean Soc Pediatr Endocrinol. 2011. 16:24-30.
    CrossRef
  17. Kim JB, Wright HM, Wright M, et al. ADD1/SREBP1 activates PPARγ through the production of endogenous ligand. Proc Natl Acad Sci USA. 1998. 95:4333-4337.
    Pubmed KoreaMed CrossRef
  18. Kim WK, Jung H, Kim DH, et al. Regulation of adipogenic differentiation by LAR tyrosine phosphatase in human mesenchymal stem cells and 3T3-L1 preadipocytes. J Cell Sci. 2009. 122:4160-4167.
    Pubmed CrossRef
  19. Kim YH, Park CM, Yoon GA. Amelioration of metabolic disturbances and adipokine dysregulation by mugwort (Artemisia princeps P.) extract in high-fat diet-induced obese rats. J Nutr Health. 2016. 49:411-419.
    CrossRef
  20. Krycer JR, Sharpe LJ, Luu W, et al. The Akt-SREBP nexus: cell signaling meets lipid metabolism. Trends Endocrinol Metab. 2010. 21:268-276.
    Pubmed CrossRef
  21. Kwon HY, Choi SI, Han X, et al. Antiobesity effect of Brassica juncea cultivated in Jeongseon with optimized sinigrin content using 3T3-L1 adipocytes. J Food Biochem. 2021. 45:e13650. https://doi.org/10.1111/jfbc.13650
    Pubmed CrossRef
  22. Lee HW, Rhee DK, Kim BO, et al. Inhibitory effect of sinigrin on adipocyte differentiation in 3T3-L1 cells: Involvement of AMPK and MAPK pathways. Biomed Pharmacother. 2018a. 102:670-680.
    Pubmed CrossRef
  23. Lee JJ, Shin HD, Lee YM, et al. Effect of broccoli sprouts on cholesterol-lowering and anti-obesity effects in rats fed high fat diet. J Korean Soc Food Sci Nutr. 2009. 38:309-318.
    CrossRef
  24. Lee KH, Song JL, Park ES, et al. Anti-obesity effects of starter fermented kimchi on 3T3-L1 adipocytes. Prev Nutr Food Sci. 2015. 20:298-302.
    Pubmed KoreaMed CrossRef
  25. Lee NK, Cheon CJ, Rhee JK. Anti-obesity effect of red radish coral sprout extract by inhibited triglyceride accumulation in a microbial evaluation system and in high-fat diet-induced obese mice. J Microbiol Biotechnol. 2018b. 28:397-400.
    Pubmed CrossRef
  26. Leroy P, Dessolin S, Villageois P, et al. Expression of ob gene in adipose cells: Regulation by insulin. J Biol Chem. 1996. 271:2365-2368.
    Pubmed CrossRef
  27. Lim H, Seo J, Chang YH, et al. Anti-obesity effects of Jeju Hallabong Tangor (Citrus kiyomi×ponkan) peel extracts in 3T3-L1 adipocytes. J Korean Soc Food Sci Nutr. 2014. 43:1688-1694.
    CrossRef
  28. Liu F, Kim JK, Li Y, et al. An extract of Lagerstroemia speciosa L. has insulin-like glucose uptake-Stimulatory and adipocyte differentiation-inhibitory activities in 3T3-L1 cells. J Nutr. 2001. 131:2242-2247.
    Pubmed CrossRef
  29. Murugan DD, Balan D, Wong PF. Adipogenesis and therapeutic potentials of antiobesogenic phytochemicals: Insights from preclinical studies. Phytother Res. 2021. 35:5936-5960.
    Pubmed CrossRef
  30. Oh S, Moon KH, Song EY, et al. Photosynthesis, productivity, and mineral content of winter radishes by soil type on Jeju island. Hortic Sci Technol. 2019. 37:167-177.
    CrossRef
  31. Oh SK, Kim KW, Bae SO, et al. Sinigrin content of different parts of Dolsan leaf mustard. Korean J Food Preserv. 2015. 22:553-558.
    CrossRef
  32. Park SY, Oh EK, Lim Y, et al. Metabolites profiling and hypolipidemic/hypocholesterolemic effects of persimmon (Diosyros kaki Thumb.) by different processing procedures: in vitro and in vivo studies. J Nutr Health. 2018. 51:275-286.
    CrossRef
  33. Park YK, Kim HM, Park MW, et al. Physicochemical and functional properties of turnip. J Korean Soc Food Sci Nutr. 1999. 28:333-341.
  34. Savova MS, Vasileva LV, Mladenova SG, et al. Ziziphus jujuba Mill. leaf extract restrains adipogenesis by targeting PI3K/ AKT signaling pathway. Biomed Pharmacother. 2021. 141:111934. https://doi.org/10.1016/j.biopha.2021.111934
    Pubmed CrossRef
  35. Statistics Korea. Obesity rate. 2022 [cited 2022 Mar 31]. Available from: https://www.index.go.kr/unify/idx-info.do?idxCd=8021
  36. Talalay P, Fahey JW. Phytochemicals from cruciferous plants protect against cancer by modulating carcinogen metabolism. 2001. J Nutr. 131:3027S-3033S.
    Pubmed CrossRef
  37. Tena N, Martin J, Asuero AG. State of the art of anthocyanins: Antioxidant activity, sources, bioavailability, and therapeutic effect in human health. Antioxidants. 2020. 9:451. https://doi.org/10.3390/antiox9050451
    Pubmed KoreaMed CrossRef
  38. Vicas SI, Teusdea AC, Carbunar M, et al. Glucosinolates profile and antioxidant capacity of Romanian Brassica vegetables obtained by organic and conventional agricultural practices. Plant Foods Hum Nutr. 2013. 68:313-321.
    Pubmed CrossRef
  39. Wang ND, Finegold MJ, Bradley A, et al. Impaired energy homeostasis in C/EBPα knockout mice. Science. 1995. 269:1108-1112.
    Pubmed CrossRef
  40. Wang T, Liang H, Yuan Q. Optimization of ultrasonic-stimulated solvent extraction of sinigrin from Indian mustard seed (Brassica Juncea L.) using response surface methodology. Phytochem Anal. 2011. 22:205-213.
    Pubmed CrossRef
  41. Yang D, Hong S, Lee HS, et al. Inhibitory effect of black radish extract (Raphanus sativus L. var. niger) on adipogenesis in 3T3-L1 cells. J Korean Soc Food Sci Nutr. 2019. 48:811-822.
    CrossRef
  42. Yang HS, Choi YJ, Jin HY, et al. Effects of Allium hookeri root water extracts on inhibition of adipogenesis and GLUT-4 expression in 3T3-L1 adipocytes. Food Sci Biotechnol. 2016. 25:615-621.
    Pubmed KoreaMed CrossRef
  43. Yu W, Chen Z, Zhang J, et al. Critical role of phosphoinositide 3-kinase cascade in adipogenesis of human mesenchymal stem cells. Mol Cell Biochem. 2008. 310:11-18.
    Pubmed CrossRef
  44. Zebisch K, Voigt V, Wabitsch M, et al. Protocol for effective differentiation of 3T3-L1 cells to adipocytes. Anal Biochem. 2012. 425:88-90.
    Pubmed CrossRef

Article

Article

Journal of the Korean Society of Food Science and Nutrition 2022; 51(10): 1015-1026

Published online October 31, 2022 https://doi.org/10.3746/jkfn.2022.51.10.1015

Copyright © The Korean Society of Food Science and Nutrition.

순무(Brassica rapa L.)와 월동무(Raphanus sativus L.)의 PI3K/AKT 조절을 통한 Adipogenesis 및 Lipogenesis 억제 효과

황혜정1,2․박나영1․황인국1․강해주1․방경원1․황경아1

1농촌진흥청 국립농업과학원 농식품자원부
2고려대학교 식품생명공학과

Received: May 19, 2022; Revised: July 8, 2022; Accepted: July 21, 2022

Inhibitory Effects of Brassica rapa L. and Raphanus sativus L. on Adipogenesis and Lipogenesis through PI3K/AKT Pathway Regulation in C3H10T1/2 Cells

Hye-Jeong Hwang1,2 , NaYeong Park1, In Guk Hwang1, Hae Ju Kang1, Kyeong Won Bang1, and Kyung-A Hwang1

1Department of Agrofood Resources, National Institute of Agricultural Sciences, RDA
2Department of Food and Biotechnology, Korea University

Correspondence to:Kyung-A Hwang, Department of Agrofood Resources, National Institute of Agricultural Sciences, RDA, 166, Nongsaengmyeong-ro, Iseo-myeon, Wanju-Gun, Jeonbuk 55365, Korea, E-mail: kah366@korea.kr

Received: May 19, 2022; Revised: July 8, 2022; Accepted: July 21, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Radish (Raphanus sativus L.) is a representative root vegetable widely cultivated in Asia and known to have various physiological effects, such as gastric protective, anti-inflammatory, antioxidant, and hemostasis improving effects, and to ameliorate digestive disorders. However, studies on the antiobesity effects of white and red radish are inadequate. Therefore, in this study, the anti-adipogenic and anti-lipogenic effects of Ganghwa (RG) and Jeju (RJ) radishes were investigated in C3H10T1/2 cells. Lipid accumulation inhibition by Oil Red O staining and TG contents confirmed that at 1,000 μg/mL RG and RJ significantly inhibited lipid accumulation and dose-dependently reduced the mRNA and protein levels of major adipogenesis and lipogenesis-related factors. In addition, inhibition of the expression of genes in the PI3K/Akt pathway by RG or RJ markedly increased leptin and adiponectin levels. These results indicate radishes are potential functional materials that inhibit adipocyte differentiation and lipid accumulation.

Keywords: radish extracts, adipogenesis, lipogenesis, antiobesity, functional food

서 론

비만은 섭취 에너지 대비 소비량 부족 시 체내 에너지 불균형으로 인해 지방세포의 크기나 수가 증가하는 것을 말한다. 비만 유병률은 전 세계적으로 지속적인 증가세를 보이며, 세계보건기구(World Health Organization; WHO)에 따르면 2025년까지 인구의 30%가 과체중 또는 비만인일 것으로 추정된다(Hwang 등, 2022). 또한, 국내에서도 비만율은 증가하고 있으며 2020년 국민건강영양조사 결과 비만율(BMI 25 이상)은 38.3%에 육박하고 있다(Statistics Korea, 2022). 비만은 고혈압, 당뇨병, 고지혈증 등의 대사질환 유발을 초래하므로 건강 문제로 대두되고 있다. 이로 인해 최근에 항비만 천연물 소재를 탐색하여 건강기능식품 및 의약품을 개발하는 연구가 활발하게 진행되고 있다. 최근 연구들에 따르면 녹차, 강황, 풋사과 추출물 등의 천연물 소재의 지방 축적 억제 효과가 보고되고 있다(Yang 등, 2019).

체내 지방 축적과 지방세포의 형성은 지방 전구세포가 성숙한 지방세포로 분화되는 adipogenesis 과정에서 지방이 과도하게 생성되어 발생하며(Brun과 Spiegelman, 1997), lipogenesis 과정에서 지방 합성 관련 유전자들에 의해 조절된다. Adipogenesis의 전체 과정을 제어하는 대표적인 전사인자로는 peroxisome proliferator activated receptor-γ(PPARγ), CCAAT/enhancer binding proteins(C/EBPα, β) 및 sterol regulatory element binding protein-1c(SREBP-1c)가 있으며, 양성 피드백 메커니즘에 따라 상호 활성화됨으로써 하위 단계인 지방생성 관련 유전자의 발현을 활성화한다(Murugan 등, 2021). 지방합성에 관여하는 주요 유전자로는 adipocyte protein 2(Ap2), fatty acid synthase(Fas), steroyl-CoA desaturase1(Scd1) 등이 알려져 있으며, 지방세포의 분화를 촉진하는 전사인자 및 유전자의 발현을 억제하면 체지방 합성 및 축적이 억제되므로 체지방 감소 효과를 평가하는 주요 지표들로 활용되고 있다. 또한, 지방세포 분화에는 내분비기관도 관여하므로 관련 호르몬을 통해 비만 상태를 판단할 수 있다. 이 중 leptin과 adiponectin은 식욕 조절 호르몬으로 비만 시 leptin 수용체의 민감성이 저하되어 중성지방의 축적으로 인해 leptin 합성이 촉진되고(Kim 등, 2016) 세포의 신진대사 및 지방생성에 관여하는 phosphoinositide 3-kinase(PI3K)/protein kinase B(AKT)/mammalian target of rapamycin(mTOR) 신호전달을 활성화함으로써 지방분화를 촉진한다(Krycer 등, 2010). Adiponectin은 지방분화세포에서 C/EBPα와 PPARγ의 활성화로 발현이 증가하는 것으로 알려져 있다(El-Jack 등, 1999).

무(Raphanus sativus L.)는 국내외에서 널리 재배되는 십자화과(Brassicaceae)에 속하는 대표적인 근채류 중 하나이다. 최근 국내에서 재배되는 무의 생산량은 평년 기준 116만 8천 톤 내외에 달하며(Han, 2021) 다양한 품종들이 재배되고 있는데, 그 종류로는 순무, 조선무, 열무 등이 있다. 이 중 순무는 일반 무와 달리 뿌리가 적자색이며, 국내에서 대표적으로 재배되는 지역 특산무는 강화 순무(Brassica rapa L.)이다. 또한, 파종 및 수확시기에 따라서도 봄무, 여름무, 가을무, 월동무(겨울무)로 구분되는데, 이 중 월동무는 주로 9월 하순 또는 10월 상순에 파종하여 12월부터 다음 해 4월까지 수확된 것을 말하며 제주지역에서의 재배 작형이 꾸준히 증가하고 있다(Oh 등, 2019). 무는 수분과 섬유질을 풍부하게 함유하고 있으며, 비타민 A와 C의 함량이 높아 영양학적 가치가 우수한 농산물이다. 또한 전통적으로 소화작용 촉진, 위 보호, 항염, 항암, 항산화, 지혈작용 등 다양한 효능을 지녔다고 알려져 왔다(Jung 등, 2008). 이러한 생리활성 효과는 무에 풍부하게 함유된 glucosinolate, isothiocyanate, flavonoid, anthocyanin, alkaloid, saponin, phenolic acid 등 다양한 기능성 성분에서 찾아볼 수 있다. 이처럼 무는 기능성 성분에 의해 다양한 생리활성에 대한 연구가 활발히 이루어지고 있지만, 아직 무의 항비만 활성 및 작용기전에 관한 연구와 무의 종류에 따른 효능을 비교한 연구는 부족한 실정이다. 순무는 다른 무에 비해 anthocyanin이 풍부하여 항산화 등 생리활성 효능이 더 높은 것으로 보고되고 있다(Park 등, 1999; Tena 등, 2020). 따라서 본 연구에서는 월동무와 순무의 항비만 효능에 대하여 비교 평가하고, 향후 기능성 식품소재로의 개발을 위한 기초자료로써 활용 및 제공하고자 한다.

재료 및 방법

재료 및 시약

본 연구에서 사용된 무는 순무(radish of Ganghwa; RG)와 월동무(radish of Jeju; RJ) 두 종류로, 각각 강화도 영농조합법인 영인팜(Ganghwa, Korea)과 제주도 농업회사법인 한스에코팜(Jeju, Korea)에서 10~12월에 수확한 것을 구입하였다. Dexamethasone, 3-isobutyl-1-methylxanthine(IBMX), insulin, troglitazone, dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide(MTT), Oil Red O solution, formalin, NP-40, triton X-100, sodium deoxychlolate, Tris-HCl, sodium chloride, EDTA, 3-mercaptoethanol은 Sigma-Aldrich Co.(St. Louis, MO, USA)에서 구입하였고, 세포배양에 사용된 Roswell Park Memorial Institute 1640(RPMI 1640), fetal bovine serum(FBS), penicillin-streptomycin(P/S), phosphate buffered saline(PBS), trypsin은 Gibco(Gaithersburg, MD, USA) 제품을 사용하였다. Triglyceride assay kit(ab65336), mouse adiponectin ELISA kit(ab226900), leptin mouse Simple-step ELISA kit(ab199082)은 Abcam(Cambridge, MA, USA)에서 구입하였고, free glycerol colorimetric assay kit(K630-100)은 BioVision(Milpitas, CA, USA)에서 구입한 것을 실험에 사용하였다.

추출물 제조

무의 이물질은 물로 깨끗이 세척하고 세절하여 60°C에서 24시간 열풍건조(DS-240BC, DooSung Co., Ltd., Gwangju, Korea) 후 분쇄기(M20, IKA, Staufen, Germany)로 분쇄하여 추출물 제조에 사용하였다. 분쇄된 무에 시료 중량의 20배수에 해당하는 70% 에탄올을 넣고 상온에서 24시간 교반(SMHS-6, Daihan Co., Wonju, Korea)하여 추출 후 1차 추출물을 회수하고 남은 잔량의 시료에 1차 추출과 동량의 용매를 넣어 이전과 동일한 조건으로 2차 추출을 진행하였다. 추출물은 여과지(No. 1, Whatman International Ltd., Maidstone, UK)에 여과한 후 감압회전농축기(EYELA CCA-1110, Rikakikai Co., Tokyo, Japan)로 농축하여 동결건조하였다. 동결건조된 시료 추출물은 -20°C 냉동 보관하며 실험에 사용하였다.

세포배양

마우스 유래 지방 간엽줄기세포(mesenchymal cell)인 C3H10T1/2 세포는 한국세포주은행(Seoul, Korea)에서 분양받아 실험에 사용하였다. C3H10T1/2 세포는 10% FBS와 1% P/S를 포함하는 RPMI 1640 배지로 37°C, 5% CO2 배양기(Heraeus BB15, Thermo Fisher, Waltham, MA, US)에서 배양하였다. 배양액은 2일 간격으로 교체하면서 세포 밀도가 80~90% 상태일 때 0.25% trypsin을 이용하여 계대배양하여 실험에 사용하였다. 유지 배양된 C3H10T1/2 세포는 지방분화를 위해 12-well plate에 분주하고 분화유도물질 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone이 포함된 배지(MDI)로 교체해주었다. 그 후 insulin과 troglitazone이 포함된 배지를 2일 간격으로 교체해주었으며, 분화유도 6일차에 순무와 월동무 추출물을 농도별로 처리하였다.

세포독성 측정(MTT)

시료에 대한 세포 내 독성 효과를 확인하기 위해 Lim 등(2014)의 실험방법을 변형한 MTT assay로 세포 생존율을 측정하였다. C3H10T1/2 지방전구세포를 96-well plate에 분주하여 2시간 안정화한 후 순무 및 월동무 추출물을 농도별(200, 500, 1,000 μg/mL)로 처리하여 24시간 배양하였다. 또한, MDI 및 troglitazone으로 6일 동안 지방구를 분화시킨 지방분화세포에 추출물을 농도별로 처리하고 24시간 배양하였다. 배양 완료 후 5 mg/mL의 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide(MTT)를 첨가하여 4시간 재배양하였다. 이후 상등액을 제거하고 DMSO를 각 well에 첨가하여 formazan dye를 용해하여 540 nm에서 흡광도를 측정하였다.

Oil Red O 염색

지방분화가 유도된 C3H10T1/2 세포의 지방 생성 정도는 Zebisch 등(2012)의 방법을 변형하여 Oil Red O(ORO) 염색법으로 측정하였다. C3H10T1/2 세포를 12-well plate에 분주하여 MDI 및 troglitazone으로 지방이 분화된 세포에 시료를 농도별(200, 500, 1,000 μg/mL)로 처리하고 24시간 배양하였다. 배양 완료 후 상등액은 제거하고 PBS로 세척하여 10% formalin(approx. 4% formaldehyde)으로 30분간 고정한 후 증류수와 PBS로 세척하고 증류수와 ORO 염색 시약을 4:6(v/v)으로 희석하여 각 well에 첨가하여 30분 동안 염색시켰다. 지방구(lipid droplet)가 염색되면 염색 시약을 제거하고 세척한 후 분화된 양상을 현미경(Leica DMi8, Leica, Mannheim, Germany)으로 촬영하고 isopropanol에 녹여 520 nm에서 흡광도를 측정하였다.

Triglyceride 및 free glycerol 생성량 측정

C3H10T1/2 세포에 생성된 중성지방 함량과 분해 효능을 확인하기 위하여 triglyceride(TG) assay kit과 free glycerol colorimetric assay kit을 이용하여 제조사 매뉴얼에 따라 TG와 free glycerol 생성량을 측정하였다. 분화된 C3H10T1/2 세포에 농도별(200, 500, 1,000 μg/mL) 시료를 처리하여 24시간 배양 후 세포를 PBS로 세척하고 cell scraper로 회수하였다. 회수한 세포는 원심분리하여 상층액을 제거한 후 TG assay에 사용할 sample은 cell pellet에 5% NP-40 용액을 첨가하여 균질화한 후 4°C, 27,000×g 에서 2분간 원심분리하여 상층액을 assay에 사용하였고, free glycerol assay는 cell pellet에 assay buffer를 첨가하여 균질화한 후 10분간 원심분리한 상층액을 분석에 사용하였다. TG assay와 free glycerol assay는 제조사의 사용법에 따라 수행되었으며, microplate reader를 이용해 570 nm에서 흡광도를 측정하였다. Triglyceride와 free glycerol 함량은 각 표준물질의 검량선을 기준으로 계산하였다.

mRNA 발현량 측정

분화된 C3H10T1/2 세포에 농도별(200, 500, 1,000 μg/mL) 시료 처리 후 배양이 완료된 세포의 total RNA 추출은 RNeasy mini kit(Qiagen, Helden, Germany)을 사용하였으며, 추출된 RNA는 reverse transcription system kit(Promega, Madison, WI, USA)을 이용하여 cDNA를 합성하였다. 실험에 사용된 kit은 제조사의 매뉴얼을 기반으로 사용하였다. 합성한 cDNA는 SYBR Green mix(Gendepot, Barker, TX, USA)를 사용하여 지방세포 분화 인자 C/ebpα, C/ebpβ, Pparγ, Srebp-1c, Ap2, Fas, Sd1Pi3k/Akt/mTOR 신호전달 관련 인자 Irs1, Pi3k, Akt, mTOR의 mRNA 발현 정도를 real-time PCR detection system (CFX96TM, Bio-Rad, Hercules, CA, USA)으로 분석하였다. 모든 실험 결과는 Gapdh를 internal control로 사용하여 보정했으며 실험에 사용된 primer의 염기서열은 Table 1과 같다.

Table 1 . Sequence of primers used for real time PCR.

Target genePrimerSequences (5'→3')
C/ebpαForwardGCAAAGCCAAGAAGTCGGTG
ReverseTCACTGGTCAACTCCAGCAC
C/ebpβForwardGAAGACGGTGGACAAGCTGA
ReverseGCTTGAACAAGTTCCGCAGG
PparγForwardGGGGATGTCTCACAATGCCA
ReverseGATGGCCACCTCTTTGCTCT
Srebp-1cForwardGAGCCAAAAGGGTCATCATC
ReverseTAAGCAGTTGGTGGTGCAGG
Ap2ForwardCACCGCAGACGACGACAGGAAG
ReverseGCACCTGCACCAGGGC
FasForwardGAGCCAAAAGGGTCATCATC
ReverseTAAGCAGTTGGTGGTGCAGG
Scd1ForwardCCAACACAATGGCATTCCAG
ReverseTATCCATAGAGATGCGCGGC
Irs1ForwardAAGGCCAGCACCTTACCTCG
ReverseAGCCATGGTGGCCCTGGGCAG
Pi3kForwardGAAGTTGCTCTACCCAGTGTCC
ReverseGATAGCCGTTCTTTTCATTTGG
AktForwardACTCATTCCAGACCCACGAC
ReverseAGCCCGAAGTCCGTTATCTT
mTORForwardTGTGAACGGAACATACGACC
ReverseTTGCTTGCCCATCAGAGTCAG
GapdhForwardGTCAAGGCTGAGAACGGGAA
ReverseAAATGAGCCCCAGCCTTCTC


단백질 발현량 측정

각 시료의 지방합성 억제 효능을 확인하기 위해 지방세포 분화 인자(C/EBPα, C/EBPβ, PPARγ, SREBP-1c)와 지방합성인자(aP2, FAS, SCD1), PI3K/AKT/mTOR 신호전달 인자(IRS1, p-PI3K, p-AKT, p-mTOR)의 단백질 발현량을 western blot으로 측정하였다. 분화된 C3H10T1/2 세포에 시료를 농도별(200, 500, 1,000 μg/mL)로 처리하고 24시간 배양 후 PBS로 세척하여 cell scraper로 회수한 뒤 RIPA buffer(0.5% NP-40, 0.5% TritonX-100, 0.1% sodium deoxycholate, 50 mM Tris-Hcl, 150 mM sodium chloride, 1 mM EDTA)를 이용해 단백질을 분리하였다. 용해한 세포는 40분 동안 ice에 방치 후 4°C, 12,000×g에서 20분간 원심분리하였고, 수득된 단백질의 농도는 BCA 방법으로 정량하였다. 단백질은 4~20% SDS-PAGE gel(Bio-Rad) 상에서 분리되었고 PVDF membrane으로 옮겨 antibody의 비특이적 반응 억제를 위해 5% skim milk에 1시간 동안 반응시켰다. 1차 항체는 4°C에서 overnight 시킨 후 1× TBST로 세척하여 2차 항체를 상온에서 1시간 동안 반응시켰다. 단백질은 ECL(Pierce, Rockford, IL, USA)과 Chemi-doc image(Bio-Rad)를 사용하여 결과를 분석하였다.

Leptin 및 adiponectin 생성량 측정

지방 축적에 관여하는 에너지대사 조절인자인 leptin과 adiponectin의 생성량을 측정하기 위해 ELISA kit을 이용하였다. 지방분화 세포에 시료를 농도별(200, 500, 1,000 μg/mL)로 처리한 후 배양이 완료된 상등액을 취하여 4°C에서 20,000×g에 10분간 원심분리하여 debris를 제거하고 회수한 상등액을 실험에 사용하였다. Leptin과 adiponectin의 생성량 측정은 각 제조사의 사용법에 따라 수행되었으며, microplate reader를 이용하여 450 nm에서 흡광도를 측정하였다. Leptin과 adiponectin의 함량은 각 표준물질의 표준곡선을 이용하여 계산하였다.

통계분석

모든 실험은 3회 이상 실시하여 얻은 결과를 평균±평균오차(mean±SEM)로 나타내어 통계 프로그램 SPSS(20.0.0, IBM Co., Armonk, NY, USA)로 분석하였다. 실험군 간의 유의적 차이는 one-way analysis of variance(ANOVA)로 분석하였으며 P<0.05인 경우 통계적 유의성이 있는 것으로 판단하여 Duncan's multiple range 사후분석을 수행하였다.

결과 및 고찰

무 추출물 처리에 의한 세포독성 평가

월동무와 순무 추출물에 대한 세포독성을 확인하기 위해 지방전구세포와 분화된 지방세포에 각 시료를 농도별로 처리하여 세포 생존율을 평가하였다. 그 결과 지방전구세포에 시료를 농도별(200, 500, 1,000 μg/mL)로 처리했을 때, 순무와 월동무 처리군에서 대조군 대비 각각 100, 97, 89% 그리고 99, 93, 82%의 세포 생존율을 나타내었다(Fig. 1A). 또한, 각 추출물을 분화된 지방세포에 처리한 결과, 순무(103, 104, 103%)와 월동무(103, 102, 103%) 처리군 모두 세포독성이 관찰되지 않았다(Fig. 1B). 십자화과 식물인 적양배추 추출물의 1,000 μg/mL 농도에서 100% 이상의 세포 생존율을 나타내었고(Ha와 Lee, 2014), 브로콜리 추출물의 항염증 효능 평가에서도 1,000 μg/mL까지 세포독성이 없음을 보고하였다(Kim, 2019). 따라서 본 연구에서도 1,000 μg/mL를 최대농도로 설정하여 추후 실험을 진행하였다.

Fig 1. Effects of RG and RJ extracts on cell viability treatment in (A) preadipocyte and (B) adipocyte C3H10T1/2 cells. The data shown are representative of triplicate experiments. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; ANOVA, analysis of variance.

무 추출물의 지방구 형성 및 지질 축적 억제 효과

순무와 월동무 추출물이 지방세포 내 지방구 축적에 미치는 영향을 확인하기 위하여 지방분화 세포에 ORO 염색을 실시하여 현미경 관찰 및 정량분석을 실시하였다. 분화되지 않은 지방세포에서는 지방구가 형성되지 않았으며, MDI와 troglitazone을 처리하여 분화를 유도한 대조군에서는 많은 수의 지방구가 형성되어 염색된 것을 확인하였다. 이후 순무 및 월동무 추출물의 지방구 축적 억제 효과를 평가하기 위해 지방이 분화된 세포에 각 추출물을 농도별로(200, 500, 1,000 μg/mL) 처리한 후 ORO 염색법을 통해 염색된 지방구를 현미경으로 확인하였다. 그 결과, 순무와 월동무 추출물 모두 MDI 처리 대조군 대비 지방구 축적이 유의적으로 감소한 것을 확인하였다(Fig. 2A). 이후 염색된 지방구를 isopropanol에 용해시켜 흡광도를 측정한 결과, 지방분화 세포군에서 분화가 유도되지 않은 대조군보다 지방구 축적 정도가 48% 높게 나타났고 순무 추출물 처리군은 지방분화 세포군 대비 각 농도에서 약 12% 이상 감소하였으며, 통계적으로 유의한 차이가 있었다(P<0.05). 또한 월동무 추출물 처리 시 지방분화 세포군 대비 20% 이상 감소하였고, 특히 1,000 μg/mL 농도에서는 26%까지 감소시키는 것을 확인하였다(Fig. 2B). Yang 등(2019)의 연구 결과에 따르면 3T3L1 세포에 검정 무 추출물을 처리하였을 때 지방구 형성 및 TG 생성이 감소한다고 보고하였고, 적무 새싹 추출물은 마우스 모델에서 체중 감소와 혈중 TG 함량을 감소시킨다고 보고하였다(Lee 등, 2018b). 십자화과 식물 유래 추출물에서 항비만 효과를 나타낸 것과 같이 순무와 월동무 추출물에서도 지방구 축적이 억제되는 것을 확인하였으므로, 순무와 월동무 추출물도 항비만 소재로서 가능성을 확인하였다.

Fig 2. Effects of RG and RJ extracts on intracellular lipid accumulation in C3H10T1/2 cells. (A) Oil Red O staining was performed and visualized by microscopy (×200 magnification). (B) Lipid accumulation was evaluated by measuring of absorbance at 540 nm. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.

무 추출물의 triglyceride 및 free glycerol 생성 조절 효과

C3H10T1/2 세포에서 순무와 월동무에 대한 TG 생성 억제 효과를 확인하기 위하여 TG assay를 진행하였다(Fig. 3A). MDI를 처리한 대조군의 TG 함량은 61.8 mM로 분화되지 않은 대조군보다 높은 함량을 보여 지방세포 분화가 적절히 이루어졌음을 확인하였다. 순무 추출물 처리군에서는 TG 함량이 시료의 농도 의존적으로 유의적인 감소 추세를 보였으며, 1,000 μg/mL 농도에서 대조군보다 23% 감소시킨 것을 확인하였다. 월동무 추출물 처리군의 TG 함량은 200, 500, 1,000 μg/mL 농도에서 각각 47.2, 55.8, 58.9%로 농도 의존적으로 감소하는 경향을 보였으며, MDI 처리 대조군 대비 통계적으로 유의한 차이를 나타냈다(P<0.05). 특히 500과 1,000 μg/mL 농도의 월동무 추출물 처리 시 순무 처리군보다 1.2배 이상 낮게 TG가 축적되었다.

Fig 3. Effects of RG and RJ extracts on triglyceride accumulation and free glycerol release in C3H10T1/2 cells. (A) Triglyceride contents was analyzed by triglyceride quantification assay kit. (B) Free glycerol contents was measured by glycerol assay. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.

지방세포 내 축적된 TG가 분해되면 glycerol과 지방산으로 나누어지므로 free glycerol 함량은 TG의 분해 정도를 간접적으로 나타내는 척도로서 사용된다(Liu 등, 2001). 본 연구에서 C3H10T1/2 세포에서 각 추출물의 triglyceride 분해 촉진 효능을 평가하기 위하여 free glycerol assay를 실시한 결과, 지방전구세포보다 MDI 처리 대조군에서 free glycerol 함량이 46% 낮은 것을 확인하였다(Fig. 3B). 순무와 월동무 추출물 처리군은 농도 의존적으로 free glycerol의 함량이 증가하는 경향을 보였으며, 모든 농도에서 MDI 처리 대조군 대비 1.6배 이상 유의적으로 높은 함량을 나타내었다(P<0.05). 특히, 순무와 월동무 추출물의 최고농도에서 각각 3.2 mM과 3.5 mM로 free glycerol 함량이 유의적으로 높게 나타나 두 추출물 모두 TG 분해 효과가 뛰어남을 확인하였다(P<0.05). Jang 등(2008)은 고콜레스테롤 식이 섭취 흰쥐에 무청 파우더 급여 시 분변 내 콜레스테롤, 중성지방 등의 배설이 증가하였다고 보고하였으며, Lee 등(2009)은 고지방식이로 비만을 유도한 흰쥐에서 브로콜리 새싹 추출물 섭취가 부고환 지방조직 내 중성지방 함량을 유의적으로 저하하였다고 보고하였다. 또한 배추, 무 등을 사용하여 제조한 김치추출물을 3T3-L1 지방세포에 처리 시 지방분화세포군 대비 glycerol의 함량이 증가하였다고 보고하였다(Lee 등, 2015). 선행 연구 결과들과 유사하게 본 연구에서도 순무와 월동무 추출물이 생성된 TG를 지방산과 free glycerol로 분해해 지방 축적을 억제하는 것을 확인할 수 있었다.

무 추출물의 지방세포 분화 관련 인자 유전자 및 단백질 발현 억제 효과

지방전구세포가 지방세포로 분화되는 과정에서 C/EBP family와 PPARγ, SREBP-1c와 같은 전사인자의 영향을 받아 adipogenic factor들의 발현을 유도한다. PPARγ는 이 과정을 총괄적으로 조절하여 지방세포로 분화된 상태를 유지하는 데 필수적인 주요 인자이며(Choi 등, 2013), C/EBPβ는 분화 초기에 발현되어 C/EBPα와 PPARγ 유전자가 발현되도록 유도하여 말기 분화 과정까지 촉진한다(Yang 등, 2019). 또한, SREBP-1c는 insulin의 영향으로 발현되며 PPARγ의 발현에 직접적으로 관여한다(Kim 등, 1998). 이렇게 분화된 지방세포에는 지방구 생성 및 triglyceride 축적과 같은 형태학적 특징과 더불어 aP2, FAS 및 SCD1과 같은 지방세포 특이적인 유전자의 발현으로 지방세포의 특징을 지니게 된다(Ambati 등, 2007).

순무와 월동무 추출물이 adipogenesis에 관여하는 전사인자의 발현에 미치는 영향을 확인하기 위하여 real-time PCR과 western blot을 이용하여 유전자 및 단백질의 발현 정도를 확인하였다(Fig. 4). C3H10T1/2 세포를 분화하여 순무와 월동무 추출물을 처리한 결과, C/ebpα의 mRNA 발현은 농도 의존적으로 유의하게 억제되었으며, C/ebpβ의 mRNA 발현은 모든 농도의 시료 처리군에서 MDI 처리 대조군 대비 유의적으로 감소하는 것을 확인하였다(Fig. 4A). C/EBPα 단백질의 발현량은 무 추출물 처리 시 농도 의존적으로 감소 추세를 보였으며, 월동무 추출물 1,000 μg/mL 처리군에서 단백질 발현이 가장 크게 억제됨을 확인하였다(Fig. 4B). 또한, PPARγ의 유전자와 단백질 발현은 MDI 처리 대조군 대비 시료농도에 따라 감소 추세를 보였으며, 500과 1,000 μg/mL 농도의 순무 추출물과 월동무 추출물 처리군에서 mRNA와 단백질 발현이 유의하게 억제되었다. 지방분화 초기 전사인자들의 억제 효능에 따라 SREBP-1c의 mRNA와 단백질 발현 역시 순무 및 월동무 처리에 의해 MDI 처리 대조군 대비 현저하게 감소하였으며, 월동무 처리군이 순무 처리군보다 발현량이 적게 나타났으나 두 시료 간에 유의한 차이는 없었다. Wang 등(1995)의 보고에 따르면 C/EBPα가 제거된 비만 동물모델에서 지방이 축적되지 않았다. 즉, 비만 억제 및 비만 관련 대사성 질환 예방을 위해서는 C/EBPα 등과 같은 지방세포 분화 전사인자들의 활성 억제가 중요한 부분으로 생각되는데, 본 연구에서 순무와 월동무 추출물이 지방세포 분화 전사인자들의 발현을 억제하는 것을 확인할 수 있었다. 따라서 지방분화 전사인자의 영향에 따라 발현이 조절되는 하위인자인 지방합성 관련 유전자 및 단백질 발현에 순무와 월동무 추출물이 미치는 영향에 대해 평가하였다(Fig. 4). 순무와 월동무 추출물에 의해 PPARγ의 발현이 감소함에 따라 aP2의 mRNA와 단백질 발현량이 MDI 처리 대조군 대비 유의하게 감소하였으며, 특히 월동무 추출물에서 현저하게 발현이 억제된 것을 확인하였다. aP2의 발현 감소는 세포 내 지방 합성의 감소를 유도하여 지방 축적을 억제하는 결과를 가져온다(Evans 등, 2004). 이에 순무와 월동무 추출물 처리에 따른 지방생성 억제 효과는 PPARγ와 aP2의 발현과 크게 관련이 있다고 판단된다. 또한, 지방 합성의 주요 조절인자인 SREBP-1c는 지방세포 분화 초기에 유도되며, 지방산 합성에 관여하는 FasScd1 등의 유전자 발현을 촉진한다(Park 등, 2018). 본 연구에서 순무와 월동무 추출물 처리에 의해 FAS와 SCD1의 mRNA와 단백질 발현이 MDI 처리 대조군 대비 농도 의존적으로 감소하였다. Yang 등(2019)은 검정무 추출물의 지질축적 및 adipogenesis 억제 효과가 전사인자인 C/EBPα, C/EBPδ, PPARγ, SREBP-1c 및 ADD1의 유전자의 발현 억제에 기인한다고 보고하였으며, 유채꽃 추출물도 지질 생성(PPARγ, C/EBPα, SREBP-1c, aP2) 및 합성(ACC, FAS), 지방분해(CPT-1, UCP2, PGC-1α) 인자의 단백질 발현을 조절함으로써 항비만 효능을 나타내는 것으로 확인하였다(Kwon 등, 2021). 이는 본 연구에서 순무와 월동무 추출물이 지방세포 분화 인자의 발현을 억제하는 결과와 유사하였으며, 순무와 월동무의 지방합성 억제 효능은 adipogenesis 중·후기에 발현되는 지방합성 인자들의 발현이 억제됨에 따라 나타나는 것으로 사료된다.

Fig 4. Effects of RG and RJ on mRNA expression and protein expression in C3H10T1/2 cells. (A) mRNA expression of C/ebpα, C/ebpβ, Pparγ, Srebp-1c, Ap2, Fas, and Scd-1. (B) Protein expression and densitometry analysis of C/EBPα, PPARγ, SREBP-1c, aP2, FAS, and SCD1. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.

무 추출물의 leptin 및 adiponectin 생성 평가

순무와 월동무 추출물 처리에 따른 adipogenesis에 관여하는 호르몬인 leptin과 adiponectin의 생성량을 ELISA kit으로 측정하였다(Fig. 5). Adiponectin은 인슐린 저항성을 개선시켜 체내 지질량을 조절하는 호르몬으로 알려졌지만(Hotta 등, 2000) insulin growth factor binding protein(IGFBP-3), β-adrenergic에 의해 생성량이 감소하기도 한다(Kim, 2011). 또한, 지방세포 분화 시 adiponectin 수용체 증가로 PPARγ 발현이 활성화하고 adiponectin 생성을 유도한다. 따라서 순무와 월동무 처리에 의한 adiponectin의 생성량을 측정한 결과, MDI를 처리한 대조군보다 시료 처리군에서 adiponectin 생성량이 농도 의존적으로 유의하게 감소한 것을 확인하였다(Fig. 5A). 특히 순무와 월동무 추출물의 1,000 μg/mL 처리 시 각각 6.6, 6.2 ng/mL로 adiponectin 생성 감소 효능이 가장 큰 것을 확인하였다. 지방분화 시 분비되는 또 다른 호르몬 leptin은 식욕을 억제하여 에너지 소비를 증가시키고 체내 대사를 조절하는 물질로, 지방세포 내 지방 축적량이 많을수록 그 분비량이 증가한다고 알려져 있으며 혈중 leptin의 농도는 체지방량을 나타내는 지표로 사용되고 있다(Leroy 등, 1996). 분화된 지방세포 배양액에서 leptin의 생성량을 측정한 결과, MDI 처리 대조군(365 pg/mL)에서 지방전구세포군(47 pg/mL) 대비 생성량이 약 7.8배로 현저하게 증가하여 지방분화가 유발된 것을 확인하였다(Fig. 5B). 지방분화가 유발된 세포에 농도 1,000 μg/mL의 순무와 월동무 추출물 처리 시 각각 52 pg/mL, 44 pg/mL로 월동무 추출물은 지방전구세포군과 거의 유사한 수준으로 leptin 함량이 감소하는 것을 확인하였다. 이는 삼채 열수 추출물의 adipogenesis 억제 효과에 관한 이전 연구에서 3T3-L1 세포에 시료 처리 시 최대 40%까지 leptin 농도가 유의적으로 감소했다고 보고한 결과와 유사한 경향을 보였다(Yang 등, 2016). Leptin은 지방 조직에서 생성되는 단백질 호르몬으로 체지방량과 양의 상관관계를 나타내며 체내 저장된 에너지양을 보여주는 지표로 알려져 있다(Chen 등, 2013; Yu 등, 2008). Leptin은 체내 여러 말초 조직뿐만 아니라 중추신경계 전체에 위치한 수용체에 결합한다. 특히 leptin 신호전달을 담당하는 주요 수용체 LepRb에 결합하면 진핵세포의 성장과 신진대사를 조절하고 영양소와 호르몬 신호를 연결하는 PI3K/AKT 신호를 활성화한다(Chen 등, 2013; Kim 등, 2009). 또한, PI3K/AKT 경로의 하위 인자들의 발현이 증가되면 지질 생합성은 촉진하고 지방분해를 억제하고 AKT는 콜레스테롤 및 지방산 축적을 증가시키는 SREBP를 통해 지질 대사를 조절하는 것으로 알려져 있다(Krycer 등, 2010; Hay, 2011). 따라서 본 연구에서 무의 지방세포 분화 및 합성 인자들의 조절 효능에 대한 명확한 작용기전을 구명하기 위해서 무의 PI3K/AKT 경로 인자들의 발현조절 연구가 수행되어야 할 것으로 생각된다.

Fig 5. Effects of RG and RJ on the production of leptin and adiponectin in the cell culture media. (A) Adiponectin and (B) leptin were measured using ELISA. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; ANOVA, analysis of variance.

무 추출물의 Pi3k/Akt 신호전달 관련 유전자 및 단백질 발현 억제 효과

순무와 월동무 추출물이 지방생성과 관련된 PI3K/AKT 신호전달 인자의 유전자 및 단백질 발현에 미치는 영향을 평가하였다(Fig. 6). 그 결과, 지방전구세포군 대비 MDI 처리 대조군에서 Irs, Pi3k, Akt, mTOR의 유전자 발현량이 증가하였고 순무와 월동무 추출물을 처리함에 따라 지방전구세포군 수준으로 유전자 발현량이 현저하게 감소하는 것을 확인하였다(Fig. 6A). 또한, 지방분화에 의해 PI3K, AKT, mTOR 단백질의 인산화는 순무 및 월동무 처리에 의해 농도 의존적으로 인산화가 억제되어 유전자 발현 수준과 유사한 경향을 나타내는 것을 확인할 수 있었다(Fig. 6B). 이러한 결과는 대추나무 잎 추출물이 PI3K/AKT 신호를 억제하여 지방 합성 인자의 발현을 감소시킨다는 Savova 등(2021)의 연구 결과와 일치하며, 순무와 월동무 추출물의 지방합성 억제는 PI3K/AKT 신호에 의해 조절될 것으로 생각된다.

Fig 6. Effects of RG and RJ on PI3K/Akt pathway (A) mRNA and (B) protein expression in C3H10T1/2 cells. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.

본 연구에서 순무와 월동무 추출물은 지방구 축적 및 TG 생성 억제, free glycerol 분해 촉진, 지방분화 유전자 및 단백질 발현 억제와 더불어 PI3K/AKT 신호전달 조절을 통한 지방세포 분비 호르몬 adipokine 생성 억제를 통해 비만 개선에 탁월한 효능을 지닌 것으로 확인되었다. 이러한 결과는 십자화과 채소에 많이 함유되어 있고, 항산화, 항암, 항비만 등의 다양한 생리활성 효능을 지닌 glucosinolate 및 isothiocyanate 화합물에 의한 것으로 생각된다(Talalay와 Fahey, 2001; Vicas 등, 2013; Becker와 Juvik, 2016). 십자화과의 기능성에 관한 연구에서 glucosinolate 화합물의 일종인 sinigrin을 지표성분으로 설정하여 많은 연구가 수행되고 있으며(Oh 등, 2015; Wang 등, 2011), 특히 sinigrin이 지방 축적 및 활성산소 감소, 지방 축적, 지방산 산화, 에너지 대사에 관련된 단백질 조절 등을 통해 비만을 개선하는 데 탁월한 효능이 있는 것으로 보고되고 있다(Lee 등, 2018a; Kwon 등, 2021). 따라서 본 연구에서도 무 추출물의 glucosinolate 및 isothiocyanate 화합물, sinigrin 등의 기능성 성분이 항비만 효능에 영향을 주었다고 생각되나, 향후 순무와 월동무에 함유된 주요 기능성 성분에 관한 연구가 이루어져야 할 것으로 생각된다.

요 약

본 연구에서는 순무(RG)와 월동무(RJ)의 항비만 효과를 확인하고자 MDI로 분화를 유도한 C3H10T1/2 세포에서 지질 축적 및 지방합성 억제 효과를 평가하였다. 무 추출물을 처리한 지방분화 세포의 지질 축적 정도와 triglyceride 함량을 측정한 결과, 무 추출물에 의해 지방구 형성과 triglyceride 축적을 감소시켰고, 특히 RJ 1,000 μg/mL 처리 시 높은 억제 효과를 보였다. 또한, 지방분화를 통해 지방구 형성(adipogenesis)에 관여하는 전사인자(C/EBPα와 β, PPARγ, SREBP-1c)와 지방합성(lipogenesis)에 관여하는 인자(aP2, FAS, SCD1)의 발현량을 측정한 결과, 시료 처리 농도 의존적으로 유전자와 단백질 발현량이 감소한 것을 확인하였으며, 모든 인자에서 RG 처리군보다 RJ 처리군의 효능이 더욱 우수하였다. 또한, MDI 처리 대조군에서 분비가 증가한 leptin과 adiponectin의 생성량이 무 추출물 처리에 의해 농도 의존적으로 감소하는 결과를 확인하였으며, 이러한 결과는 세포 표면 leptin 수용체에 leptin 결합에 의해 활성화되는 PI3K/AKT 신호 관련 인자들의 유전자 발현이 무 추출물 처리에 의해 억제됨으로써 지방 합성 및 지질 축적을 억제하여 무 추출물이 비만 개선에 효과적임을 밝혀냈다. 이상의 결과로부터 RG와 RJ가 지방세포 분화 기전과 지방분화 호르몬의 생성량을 억제함으로써 지방분화 및 합성 억제 효능이 우수함을 확인하였다. 향후 전임상 효능 평가와 RG와 RJ가 함유한 기능성 성분 연구가 이루어진다면 체지방감소에 도움을 주는 건강기능식품 소재로서의 활용 가능성을 제시할 수 있을 것으로 생각된다.

감사의 글

본 연구는 농촌진흥청 국립농업과학원 농업과학기술 연구개발사업(과제번호: PJ015144012022)의 지원을 받아 연구되었음.

Fig 1.

Fig 1.Effects of RG and RJ extracts on cell viability treatment in (A) preadipocyte and (B) adipocyte C3H10T1/2 cells. The data shown are representative of triplicate experiments. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; ANOVA, analysis of variance.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 1015-1026https://doi.org/10.3746/jkfn.2022.51.10.1015

Fig 2.

Fig 2.Effects of RG and RJ extracts on intracellular lipid accumulation in C3H10T1/2 cells. (A) Oil Red O staining was performed and visualized by microscopy (×200 magnification). (B) Lipid accumulation was evaluated by measuring of absorbance at 540 nm. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 1015-1026https://doi.org/10.3746/jkfn.2022.51.10.1015

Fig 3.

Fig 3.Effects of RG and RJ extracts on triglyceride accumulation and free glycerol release in C3H10T1/2 cells. (A) Triglyceride contents was analyzed by triglyceride quantification assay kit. (B) Free glycerol contents was measured by glycerol assay. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 1015-1026https://doi.org/10.3746/jkfn.2022.51.10.1015

Fig 4.

Fig 4.Effects of RG and RJ on mRNA expression and protein expression in C3H10T1/2 cells. (A) mRNA expression of C/ebpα, C/ebpβ, Pparγ, Srebp-1c, Ap2, Fas, and Scd-1. (B) Protein expression and densitometry analysis of C/EBPα, PPARγ, SREBP-1c, aP2, FAS, and SCD1. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 1015-1026https://doi.org/10.3746/jkfn.2022.51.10.1015

Fig 5.

Fig 5.Effects of RG and RJ on the production of leptin and adiponectin in the cell culture media. (A) Adiponectin and (B) leptin were measured using ELISA. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; ANOVA, analysis of variance.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 1015-1026https://doi.org/10.3746/jkfn.2022.51.10.1015

Fig 6.

Fig 6.Effects of RG and RJ on PI3K/Akt pathway (A) mRNA and (B) protein expression in C3H10T1/2 cells. Values are expressed as mean±SEM. Different letters represent a significant difference from each other by ANOVA at P<0.05. RG, radish of Ganghwa; RJ, radish of Jeju; MDI, 0.5 mM IBMX, 1 μM dexamethasone, 5 μg/mL insulin, 1 μM troglitazone; ANOVA, analysis of variance.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 1015-1026https://doi.org/10.3746/jkfn.2022.51.10.1015

Table 1 . Sequence of primers used for real time PCR.

Target genePrimerSequences (5'→3')
C/ebpαForwardGCAAAGCCAAGAAGTCGGTG
ReverseTCACTGGTCAACTCCAGCAC
C/ebpβForwardGAAGACGGTGGACAAGCTGA
ReverseGCTTGAACAAGTTCCGCAGG
PparγForwardGGGGATGTCTCACAATGCCA
ReverseGATGGCCACCTCTTTGCTCT
Srebp-1cForwardGAGCCAAAAGGGTCATCATC
ReverseTAAGCAGTTGGTGGTGCAGG
Ap2ForwardCACCGCAGACGACGACAGGAAG
ReverseGCACCTGCACCAGGGC
FasForwardGAGCCAAAAGGGTCATCATC
ReverseTAAGCAGTTGGTGGTGCAGG
Scd1ForwardCCAACACAATGGCATTCCAG
ReverseTATCCATAGAGATGCGCGGC
Irs1ForwardAAGGCCAGCACCTTACCTCG
ReverseAGCCATGGTGGCCCTGGGCAG
Pi3kForwardGAAGTTGCTCTACCCAGTGTCC
ReverseGATAGCCGTTCTTTTCATTTGG
AktForwardACTCATTCCAGACCCACGAC
ReverseAGCCCGAAGTCCGTTATCTT
mTORForwardTGTGAACGGAACATACGACC
ReverseTTGCTTGCCCATCAGAGTCAG
GapdhForwardGTCAAGGCTGAGAACGGGAA
ReverseAAATGAGCCCCAGCCTTCTC

References

  1. Ambati S, Kim HK, Yang JY, et al. Effects of leptin on apoptosis and adipogenesis in 3T3-L1 adipocytes. Biochem Pharmacol. 2007. 73:378-384.
    Pubmed CrossRef
  2. Becker TM, Juvik JA. The role of glucosinolate hydrolysis products from Brassica vegetable consumption in inducing antioxidant activity and reducing cancer incidence. Diseases. 2016. 4:22. https://doi.org/10.3390/diseases4020022
    Pubmed KoreaMed CrossRef
  3. Brun RP, Spiegelman BM. Obesity and the adipocyte PPARγ and the molecular control of adipogenesis. Differentiation. 1997. 83:813-819.
  4. Chen J, Crawford R, Chen C, et al. The key regulatory roles of the PI3K/Akt signaling pathway in the functionalities of mesenchymal stem cells and applications in tissue regeneration. Tissue Eng Part B Rev. 2013. 19:516-528.
    Pubmed CrossRef
  5. Choi JH, Park YH, Lee IS, et al. Antioxidant activity and inhibitory effect of Aster scaber Thunb. extract on adipocyte differentiation in 3T3-L1 cells. Korean J Food Sci Technol. 2013. 45:356-363.
    CrossRef
  6. El-Jack AK, Hamm JK, Pilch PF, et al. Reconstitution of insulin-sensitive glucose transport in fibroblasts requires expression of both PPARγ and C/EBPα. J Biol Chem. 1999. 274:7946-7951.
    Pubmed CrossRef
  7. Evans RM, Barish GD, Wang YX. PPARs and the complex journey to obesity. Nat Med. 2004. 10:355-361.
    Pubmed CrossRef
  8. Ha HJ, Lee CB. Antioxidant and anti-inflammation activity of red cabbage extract. Korean J Culinary Res. 2014. 20(2):16-26.
    CrossRef
  9. Han ES, Kim DJ, Han BH, et al. Supply and demand trend and outlook of root vegetables. In: Agricultural Outlook 2021 Korea: Changes and Future of Agriculture and Rural Communities after COVID-19. Korea Rural Economic Institute, Naju, Korea. 2021. p 353-411.
  10. Hay N. Interplay between FOXO, TOR, and Akt. Biochim Biophys Acta. 2011. 1813:1965-1970.
    Pubmed KoreaMed CrossRef
  11. Hotta K, Funahashi T, Arita Y, et al. Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol. 2000. 20:1595-1599.
    Pubmed CrossRef
  12. Hwang HJ, Hwang YJ, Kim YJ, et al. Immature sword bean pods (Canavalia gladiata) inhibit adipogenesis in C3H10T1/2 cells and mice with high-fat diet-induced obesity. J Chin Med Assoc. 2022. 85:67-76.
    Pubmed CrossRef
  13. Jang HS, Ahn JM, Ku KH, et al. Effect of radish leaves powder on the gastrointestinal function and fecal triglyceride, and sterol excretion in rats fed a hypercholesterolemic diet. J Korean Soc Food Sci Nutr. 2008. 37:1258-1263.
    CrossRef
  14. Jung UJ, Baek NI, Chung HG, et al. Effects of the ethanol extract of the roots of Brassica rapa on glucose and lipid metabolism in C57BL/KsJ-db/db mice. Clin Nutr. 2008. 27:158-167.
    Pubmed CrossRef
  15. Kim HK. The anti-inflammatory effects of heat-treated broccoli extract. The Journal of Convergence on Culture Technology. 2019. 5:397-404.
  16. Kim HS. The effect of IGFBP-3 on adipokines and gene expression in differentiated 3T3-L1 adipocytes. J Korean Soc Pediatr Endocrinol. 2011. 16:24-30.
    CrossRef
  17. Kim JB, Wright HM, Wright M, et al. ADD1/SREBP1 activates PPARγ through the production of endogenous ligand. Proc Natl Acad Sci USA. 1998. 95:4333-4337.
    Pubmed KoreaMed CrossRef
  18. Kim WK, Jung H, Kim DH, et al. Regulation of adipogenic differentiation by LAR tyrosine phosphatase in human mesenchymal stem cells and 3T3-L1 preadipocytes. J Cell Sci. 2009. 122:4160-4167.
    Pubmed CrossRef
  19. Kim YH, Park CM, Yoon GA. Amelioration of metabolic disturbances and adipokine dysregulation by mugwort (Artemisia princeps P.) extract in high-fat diet-induced obese rats. J Nutr Health. 2016. 49:411-419.
    CrossRef
  20. Krycer JR, Sharpe LJ, Luu W, et al. The Akt-SREBP nexus: cell signaling meets lipid metabolism. Trends Endocrinol Metab. 2010. 21:268-276.
    Pubmed CrossRef
  21. Kwon HY, Choi SI, Han X, et al. Antiobesity effect of Brassica juncea cultivated in Jeongseon with optimized sinigrin content using 3T3-L1 adipocytes. J Food Biochem. 2021. 45:e13650. https://doi.org/10.1111/jfbc.13650
    Pubmed CrossRef
  22. Lee HW, Rhee DK, Kim BO, et al. Inhibitory effect of sinigrin on adipocyte differentiation in 3T3-L1 cells: Involvement of AMPK and MAPK pathways. Biomed Pharmacother. 2018a. 102:670-680.
    Pubmed CrossRef
  23. Lee JJ, Shin HD, Lee YM, et al. Effect of broccoli sprouts on cholesterol-lowering and anti-obesity effects in rats fed high fat diet. J Korean Soc Food Sci Nutr. 2009. 38:309-318.
    CrossRef
  24. Lee KH, Song JL, Park ES, et al. Anti-obesity effects of starter fermented kimchi on 3T3-L1 adipocytes. Prev Nutr Food Sci. 2015. 20:298-302.
    Pubmed KoreaMed CrossRef
  25. Lee NK, Cheon CJ, Rhee JK. Anti-obesity effect of red radish coral sprout extract by inhibited triglyceride accumulation in a microbial evaluation system and in high-fat diet-induced obese mice. J Microbiol Biotechnol. 2018b. 28:397-400.
    Pubmed CrossRef
  26. Leroy P, Dessolin S, Villageois P, et al. Expression of ob gene in adipose cells: Regulation by insulin. J Biol Chem. 1996. 271:2365-2368.
    Pubmed CrossRef
  27. Lim H, Seo J, Chang YH, et al. Anti-obesity effects of Jeju Hallabong Tangor (Citrus kiyomi×ponkan) peel extracts in 3T3-L1 adipocytes. J Korean Soc Food Sci Nutr. 2014. 43:1688-1694.
    CrossRef
  28. Liu F, Kim JK, Li Y, et al. An extract of Lagerstroemia speciosa L. has insulin-like glucose uptake-Stimulatory and adipocyte differentiation-inhibitory activities in 3T3-L1 cells. J Nutr. 2001. 131:2242-2247.
    Pubmed CrossRef
  29. Murugan DD, Balan D, Wong PF. Adipogenesis and therapeutic potentials of antiobesogenic phytochemicals: Insights from preclinical studies. Phytother Res. 2021. 35:5936-5960.
    Pubmed CrossRef
  30. Oh S, Moon KH, Song EY, et al. Photosynthesis, productivity, and mineral content of winter radishes by soil type on Jeju island. Hortic Sci Technol. 2019. 37:167-177.
    CrossRef
  31. Oh SK, Kim KW, Bae SO, et al. Sinigrin content of different parts of Dolsan leaf mustard. Korean J Food Preserv. 2015. 22:553-558.
    CrossRef
  32. Park SY, Oh EK, Lim Y, et al. Metabolites profiling and hypolipidemic/hypocholesterolemic effects of persimmon (Diosyros kaki Thumb.) by different processing procedures: in vitro and in vivo studies. J Nutr Health. 2018. 51:275-286.
    CrossRef
  33. Park YK, Kim HM, Park MW, et al. Physicochemical and functional properties of turnip. J Korean Soc Food Sci Nutr. 1999. 28:333-341.
  34. Savova MS, Vasileva LV, Mladenova SG, et al. Ziziphus jujuba Mill. leaf extract restrains adipogenesis by targeting PI3K/ AKT signaling pathway. Biomed Pharmacother. 2021. 141:111934. https://doi.org/10.1016/j.biopha.2021.111934
    Pubmed CrossRef
  35. Statistics Korea. Obesity rate. 2022 [cited 2022 Mar 31]. Available from: https://www.index.go.kr/unify/idx-info.do?idxCd=8021
  36. Talalay P, Fahey JW. Phytochemicals from cruciferous plants protect against cancer by modulating carcinogen metabolism. 2001. J Nutr. 131:3027S-3033S.
    Pubmed CrossRef
  37. Tena N, Martin J, Asuero AG. State of the art of anthocyanins: Antioxidant activity, sources, bioavailability, and therapeutic effect in human health. Antioxidants. 2020. 9:451. https://doi.org/10.3390/antiox9050451
    Pubmed KoreaMed CrossRef
  38. Vicas SI, Teusdea AC, Carbunar M, et al. Glucosinolates profile and antioxidant capacity of Romanian Brassica vegetables obtained by organic and conventional agricultural practices. Plant Foods Hum Nutr. 2013. 68:313-321.
    Pubmed CrossRef
  39. Wang ND, Finegold MJ, Bradley A, et al. Impaired energy homeostasis in C/EBPα knockout mice. Science. 1995. 269:1108-1112.
    Pubmed CrossRef
  40. Wang T, Liang H, Yuan Q. Optimization of ultrasonic-stimulated solvent extraction of sinigrin from Indian mustard seed (Brassica Juncea L.) using response surface methodology. Phytochem Anal. 2011. 22:205-213.
    Pubmed CrossRef
  41. Yang D, Hong S, Lee HS, et al. Inhibitory effect of black radish extract (Raphanus sativus L. var. niger) on adipogenesis in 3T3-L1 cells. J Korean Soc Food Sci Nutr. 2019. 48:811-822.
    CrossRef
  42. Yang HS, Choi YJ, Jin HY, et al. Effects of Allium hookeri root water extracts on inhibition of adipogenesis and GLUT-4 expression in 3T3-L1 adipocytes. Food Sci Biotechnol. 2016. 25:615-621.
    Pubmed KoreaMed CrossRef
  43. Yu W, Chen Z, Zhang J, et al. Critical role of phosphoinositide 3-kinase cascade in adipogenesis of human mesenchymal stem cells. Mol Cell Biochem. 2008. 310:11-18.
    Pubmed CrossRef
  44. Zebisch K, Voigt V, Wabitsch M, et al. Protocol for effective differentiation of 3T3-L1 cells to adipocytes. Anal Biochem. 2012. 425:88-90.
    Pubmed CrossRef