검색
검색 팝업 닫기

Ex) Article Title, Author, Keywords

JKFN Journal of the Korean Society of Food Science and Nutrition



Online ISSN 2288-5978

Article

home All Articles View

Article

Split Viewer

Journal of the Korean Society of Food Science and Nutrition 2022; 51(9): 886-893

Published online September 30, 2022 https://doi.org/10.3746/jkfn.2022.51.9.886

Copyright © The Korean Society of Food Science and Nutrition.

The In Vitro and In Vivo Inhibitory Effect of Combined Extracts of Cervus elaphus Antler, Glycyrrhiza uralensis, and Angelica gigas on Benign Prostatic Hyperplasia

Jeong Yoon Lee1 , Hyung Gu Son1, So Hyuk Kim1, Ki Won Lee2, Jin Soo Kim2, In Hwan Kim2, Young Tae Koo2, and Yoo-Hyun Lee1

1Department of Food and Nutrition, The University of Suwon
2Natural Products Convergence R&D Division, Kwangdong Pharm Co., Ltd.

Correspondence to:Yoo-Hyun Lee, Department of Food and Nutrition, College of Health Sciences, University of Suwon, 17, Wauan-gil, Bongdam-eup, Hwasung, Gyeonggi 18323, Korea, E-mail: creamut@suwon.ac.kr

Received: July 14, 2022; Revised: July 28, 2022; Accepted: July 28, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Combinations of natural products have a number of benefits. We investigated the inhibitory effect of a combination of 50% ethanol extracts of Cervus elaphus antler (CEE), Glycyrrhiza uralensis (GUE), and Angelica gigas (AGE) on benign prostatic hyperplasia (BPH) using BPH-1 cells and testosterone propionate (TP)-induced BPH rats. The combination, called CGA113, inhibited cell proliferation by decreasing the cell viability of BPH-1 cells up to 72.03% more than the individual extracts. In addition, CGA113 significantly reduced the mRNA expressions of AR and SRD5A2 in BPH-1 cells. Sprague-Dawley rats were subjected to castration surgery to remove endogenous testosterone, and 3 mg/kg testosterone propionate was subcutaneously injected to induce BPH. Subsequently, CGA113 (50 and 200 mg/kg BW/day) was orally administered to the TP-induced BPH rats for 8 weeks. In the CGA113-H group (200 mg/kg of CGA113), the prostate ratio, serum DHT, prostate DHT, and prostate 5α-reductase2 were significantly decreased compared to the BPH group. Histology with H&E staining of the prostate tissue, revealed a reduction in the thickening of the prostate epithelial cells and enlargement of the lumen compared to the BPH group. The mRNA levels of the Bax/Bcl2 ratio in prostate tissue of the CGA113-H group were significantly increased. Overall, the combined extract of CEE, GUE, and AGE, was determined to exert synergistic effects, indicating the potential of the three natural materials as therapeutic agents for alleviation of BPH symptoms.

Keywords: androgen receptor, Angelica gigas, benign prostatic hyperplasia, Cervus elaphus antler, Glycyrrhiza uralensis

양성 전립선비대증(BPH)은 중년 남성의 전형적인 배뇨 장애로, 주요 원인은 노화에 따른 성호르몬 변화와 그로 인한 전립선 기질 및 상피세포의 과도한 증식, apoptosis 조절인자의 불균형이다(Carson과 Rittmaster, 2003). 나이가 들수록 남성의 테스토스테론 수치는 감소하지만, 5α-reductase 효소활성은 증가하여 테스토스테론(T)에서 디하이드로테스토스테론(DHT)으로의 전환이 증가한다(Roehrborn, 2008). DHT는 T보다 안드로겐 수용체(AR)와의 약 10배 더 높은 친화력으로 인해 단백질 합성 및 전립선 세포 성장을 촉진한다(Deslypere 등, 1992; Park 등, 2019). BPH는 요도에 가해진 기계적 압박으로 인한 배뇨지연(hesitancy), 요폐(urinary retention), 빈뇨(urinary frequency) 및 요절박(urgency) 등의 다양한 하부요로증상(LUTS)을 동반하여(Roehrborn, 2005), 노년기 삶의 질을 떨어뜨린다. 현대사회는 평균 수명 연장으로 인하여 이러한 연령 관련 질병 치료의 중요성이 강조되고 있다(Juckett, 2010). BPH치료 약물로 가장 널리 사용되는 finasteride 및 dutasteride는 5α-redcuctase 활성 억제를 통해 DHT의 수준을 낮추고 BPH 증상을 완화하지만, 발기부전, 성욕 감소와 같은 성기능 장애 및 다양한 부작용이 보고되고 있다(Fertig 등, 2017). 따라서 최근 BPH 치료제 시장은 부작용이 적고 효능과 안전성을 갖춘 천연물 소재의 기능성 식품에 관심이 집중되고 있다(Cicero 등, 2019).

녹용(Cervus elaphus antler)은 면역 체계, 건강 증진 및 성 기능에 대한 다양한 약리학적 효과로 인해 2천 년 이상 사용되어 왔다(Sui 등, 2014). 녹용의 uronic acid, sulfated-glycosaminoglycans(sulfated-GAGs), sialic acid 성분은 항암(Wu 등, 2013), 항피로(Chen 등, 2014), 골다공증(Zhang 등, 2013), 항산화(Zhou와 Li, 2009) 효과가 있는 것으로 알려져 있다. 감초(Glycyrrhiza uralensis)는 콩과에 속하는 다년생 초본으로 단맛 성분인 글리시리진 성분을 함유하여 감미료로 사용되며(Bode와 Dong, 2015), 감초의 플라보노이드, 리코칼콘의 성분들은 항암(Wang과 Nixon, 2001), 항산화(Vaya 등, 1997) 등의 효과가 있다. 감초의 주요 폴리페놀 성분인 isoliquirigenin은 apoptosis를 억제하는 인자 Bcl-2를 감소시켜, 전립선 암세포의 apoptosis를 유도하는 것으로 알려졌다(Bode와 Dong, 2015). 당귀(Angelica gigas)는 한국 및 중국 등지에서 서식하는 다년생 식물로 건조된 뿌리를 감기, 통증 및 빈혈 치료를 위한 약재로 사용해 왔으며(Sarker와 Nahar, 2004), 당귀의 주요 활성 성분이며 쿠마린 유도체로 알려진 데커신(decursin), nodakenin, decursinol은 신경 보호 효과(Sowndhararajan과 Kim, 2017), 항염(Rim 등, 2012), 항암 효과(Zhang 등, 2012), 항안드로겐 효과 및 안드로겐 수용체 활성을 통한 전립선 암세포의 세포증식 억제 효과(Jiang 등, 2006)가 있는 것으로 보고되고 있다.

최근에는 BPH 증상을 개선하기 위해 천연물 소재 조합을 이용한 다양한 연구가 시도되고 있다. 당귀, 인삼, 백급 등 10가지 한약재로 만들어진 가미계격탕(KMKKT)은 mRNA 및 protein 수준에서 prostatic specific antigen(PSA)을 감소시키고 AR 억제를 통해 항안드로겐 효과를 나타내는 것으로 보고되었으며(Jiang 등, 2006), 또한 치자, 당귀, 황금, 차전자 등을 포함한 용담사간탕(YSTE)은 세포 주기 조절 단백질인 proliferating cell nuclear antigen(PCNA)의 감소에 의한 항증식 활성 조절을 통해 BPH 발달을 억제하고 malondialdehyde(MDA) 함량을 낮추어 항산화 효소 활성을 억제하는 것으로 보고되었다(Park 등, 2016). 이 연구에서 각 한약재의 단일 추출물이 전립선 상피세포주인 BPH-1 세포의 증식을 효과적으로 억제할 수 있으며 특히 혼합물을 이용하는 경우 억제 효능이 유의적으로 증가하는 것을 확인하였다. 일반적으로 천연물 추출물의 조합은 단일추출물에 비해 기존의 효능을 증가시키거나 상승효과를 나타낸다. 따라서 본 연구에서는 녹용, 당귀 및 감초를 포함한 복합추출물의 상승효과를 검토하기 위하여 단일추출물과 다양한 비율의 혼합물을 이용하여 세포증식 억제율을 비교하였고, 가장 효과적인 배합의 복합추출물 CGA113을 사용하여 BPH에 대한 효과를 검토하였다.

시료의 제조

본 실험에 사용된 녹용추출물(C. elaphus antler 50% ethanol extract; CEE), 감초추출물(G. uralensis 50% ethanol extract; GUE), 당귀추출물(A. gigas 50% ethanol extract; AGE), 및 복합추출물(CGA113)은 다음과 같이 제조되었다. 단일추출물인 CEE, GUE, AGE는 각각 녹용, 감초, 당귀를 50% 주정으로 1차 추출 및 2차 추출 후 농축하여 건조한 시료를 사용하였으며, 복합 추출물인 CGA113은 녹용, 감초, 당귀를 1:1:3 비율로 계량 후, 단일추출물과 동일한 방법으로 1차 및 2차 추출한 시료를 사용하였다. 본 시료들은 광동제약(Seoul, Korea)에서 제공받아 사용하였다.

세포 배양

본 연구는 인간 전립선비대 상피세포주인 BPH-1 세포(DSMZ, Braunschweig, Germany)를 사용하여 진행하였다. 세포는 37°C, 5% CO2의 환경에서 20% FBS, 1% antibiotic antimycotic solution, 20 ng/mL testosterone, 5 μg/mL transferrin, 5 ng/mL sodium selenite, 5 μg/mL insulin을 추가한 RPMI 1640 배지를 사용하여 배양되었다.

Cell viability

CEE, GUE, AGE 등의 단일추출물, 1:1:1 복합추출물 및 CGA113이 BPH-1 cell의 세포증식에 미치는 영향을 확인하기 위하여 MTT assay를 실시하였다. BPH-1 cell을 96 well plate(1×104 cell/well)에 seeding 하고 37°C, 5% CO2의 환경에서 24시간 동안 배양했다. 그 후에 각 농도(100, 200, 500, 1,000 μg/mL)의 CEE, GUE, AGE, 1:1:1 복합추출물 및 CGA113이 추가된 배지를 100 μL씩 분주하고 48시간 동안 배양하였다. 이후 MTT solution(Sigma-Aldrich Co., St. Louis, MO, USA)을 2 mg/mL의 농도로 각 well당 100 μL씩 분주하고 2시간 동안 배양하였다. 배지를 제거하고 각 well에 DMSO를 100 μL씩 분주한 후 570 nm에서 흡광도를 측정(Epoch, BioTek Instruments, Winooski, VT, USA)하였다.

실험동물

실험동물은 7주령의 수컷 Sprague-Dawley(SD) rats를 중앙실험동물(Seoul, Korea)에서 구매하였다. 1주일의 적응 기간 후에, 온도 22±2°C, 상대습도 55±5%, 명암 주기가 12시간인 환경을 유지하며 사육되었다. 물과 멸균된 사료는 자유롭게 섭취하도록 하였다. 몸무게는 이틀에 1회, 사료 무게는 식이 효율의 측정을 위하여 일주일에 2회 측정하였다. 본 실험은 수원대학교 동물실험윤리위원회의 승인(USW-IACUC-2019-003)을 받아 진행하였다.

실험군 분류 및 시료투여

일주일의 적응 기간을 거친 후 내인성 테스토스테론의 영향을 방지하기 위하여 대조군(control 군)을 제외한 모든 군을 대상으로 중성화 수술을 하였다. 각 군은 8마리로 설정하였으며 BPH의 유도를 위해 Testosterone propionate(TP)를 3 mg/kg의 농도로 corn oil에 녹여 0.1 mL씩 8주간 매일 피하주사하였고, sample 투여군은 증류수에 녹인 CGA113을 존대(Zonde)를 이용하여 8주간 경구투여를 진행하였다. 실험군은 다음과 같다. (1) control 군: corn oil을 피하주사하고 식염수를 경구투여한 군, (2) BPH 군: TP(3 mg/kg of BW/d)를 피하주사하고 식염수를 경구투여한 군, (3) CGA113-L 군: TP(3 mg/kg of BW/d)를 피하주사하고 CGA113(50 mg/kg)을 경구투여한 군, (4) CGA113-H 군: TP(3 mg/kg of BW/d)를 피하주사하고 CGA113(200 mg/kg)을 경구투여한 군.

Serum의 분리 및 장기 무게 측정

실험동물은 희생 전 12시간 동안 금식을 진행하였으며 CO2 chamber를 사용하여 희생하였다. 희생한 rat에서 혈액 및 간, 전립선을 채취하였으며 장기들의 무게를 측정하였다. 혈액은 serum 분리를 위해 20분간 3,000 rpm에서 원심분리(MF-80, Hanil Science industrial, Incheon, Korea)하여 DHT, alanine aminotransferase(ALT), aspartate aminotransferase(AST) 측정에 사용되었으며, 수집된 장기들은 phosphate buffered saline(PBS, pH7.4)에서 세척하여 -80°C에 보관 후 5α-reductase1(SRD5A1), 5α-reductase2(SRD5A2), B-cell lymphoma-2(Bcl-2) 및 Bcl-2-associated X protein(Bax) 측정에 사용되었다.

ALT, AST 측정

간 손상의 정도를 판단하는 지표인 ALT 및 AST는 건식 화학 분석기(FUJI DRI CHEM 500i, FUJI photo film Co., Ltd, Tokyo, Japan)와 건식 화학 분석기 전용 FUJI DRI-CHEM SLIDE kit(FUJI photo film Co., Ltd)을 사용하여 혈청에서의 수준을 측정하였다.

조직학적 분석

조직학적 분석을 수행하기 위해 전립선 조직을 10% formaldehyde에 고정시킨 후 탈수하여 paraffin에 포매하였다. Paraffin에 포매된 전립선 조직은 2 μm 두께로 절단하여 Hematoxyline & Eosin(H&E)으로 염색을 시행한 후 커버 글라스로 덮어 광학 현미경으로 100배 확대하여 전립선 조직을 평가하였다.

Enzyme-linked immunosorbent assay(ELISA)

전립선 조직 100 mg당 1×PBS(pH 7.4)를 1 mL 가하여 균질화를 진행하고 5,000×g, 4°C에서 5분간 원심분리하여 상등액을 채취하였다. 이후 전립선 조직 및 혈청 내 DHT, 5α-reductase1 및 5α-reductase2 수준을 측정하기 위하여 DHT, SRD5A1 및 SRD5A2 ELISA kit(Cusabio, Wuhan, China)을 사용하여 제조업체의 지침에 따라 450 nm의 흡광도에서 Epoch Microplate Spectrophotometer(BioTek Instruments)를 사용하여 측정하였다. 측정된 흡광도 값은 Curve Expert 1.3(Hyams Development)을 사용하여 계산하였다.

Quantitative real time polymerase-chain reaction (qRT-PCR)

BPH-1 cell 및 실험동물의 전립선 조직에서 BPH와 관련한 gene의 mRNA 발현에 CGA113이 미치는 영향을 알아보기 위하여 qPCR을 진행하였다. BPH-1 cell은 24 well plate(5×104 cell/well)에서 CGA113이 100~500 μg/mL의 농도로 첨가된 배지에 24시간 배양된 후 RNA 추출하였으며, 실험동물의 경우 전립선 조직을 약 50 mg 균질화하여 RNA 추출하였다. 모두 RNAiso(TaKaRa, Kusatsu, Japan)를 이용하여 RNA를 추출한 뒤, T100 Thermal Cycler(Bio-Rad, Hercules, CA, USA)를 사용하여 cDNA로 합성되었다. qPCR은 HiPi Real-Time PCR 2× Master Mix(ELPIS, Daejeon, Korea)를 사용하여 Light Cycler 96(Roche, Basel, Switzerland)으로 수행하였으며, GAPDH를 internal control로 사용하여 AR의 수준을 확인하였다. qPCR은 95°C에서 10분간 preincubation하고, 95°C에서 10초, 55°C 10초, 72°C에서 10초의 순서로 총 40회 반복한 후, 95°C 5초, 65°C 60초의 Melting curve analysis와 37°C 30초의 cooling time을 가졌다. 본 실험에서 Real-time qPCR 수행을 위해 사용된 primer의 염기서열은 Table 1과 같다.

Table 1 . Primers used for quantitative real time PCR

GeneForward primer (5′-3′)Reverse primer (5′-3′)
Human
GAPDHAGCCTTCTCCATGGTGGTGAAGACCGGAGTGAACGGATTTGGTCGTAT
SRD5A2CTACGGGAAGCACACGGAGAGCCTGAACCAGGCTTCCTGAGCTGGCGCAATATATAG
ARAGCACCATGCAACTCCTTCAGCACCGACACTGCCTTACACAA
Rat
GAPDHTGGAAGGACTCATGACCACATTCAGGTCAGGGATGACCTT
BaxCCAGGACGCATCCACCAAGAAGCTGCCACACGGAAGAAGACCTCTCG
Bcl2GAGGCTGGGATGCCTTTGTGGAGCTGAGCAGCGTCTTCAGAGA


통계분석

In vitro의 결과는 mean±standard deviation(SD), in vivo의 결과는 mean±standard error(SE)로 표기하였으며 통계의 처리는 SPSS(Ver. 20, IBM Corporation, Armonk, NY, USA) 프로그램을 사용하였다. 실험군 간의 차이는 일원배치 분산분석(One-way ANOVA)과 Duncan’s multiple range tests의 사후 검증을 실시하여, 각 군의 유의성 검정을 통해 확인하였다(P<0.05).

CGA113과 단일추출물 및 혼합물의 in vitro 전립선 세포증식 억제 효과 비교

Fig. 1은 전립선비대세포인 BPH-1에서 녹용, 당귀, 감초의 50% 에탄올 추출물인 CEE, GUE, AGE와 각 추출물을 1:1:1 비율로 혼합한 것 그리고 복합추출물인 CGA113의 세포증식 억제 효과를 확인한 결과이다. 단일 혹은 복합추출물은 100~1,000 μg/mL까지의 다양한 농도에서 모두 유의적으로 세포증식을 억제하였다. 단일추출물의 경우 AGE처리군에서 농도 의존적으로 감소하였으며, 1,000 μg/mL에서 67.58%까지 유의적으로 억제하였다. 단일추출물들 조합의 상승효과를 검토하기 위하여 CEE, GUE, AGE를 1:1:1 비율로 혼합하여 처리한 후 cell viability를 확인하였다. 무첨가군에 해당하는 0 μg/mL 농도의 cell viability를 100%라고 할 때 1:1:1 혼합물 100 μg/mL 농도에서 약 33.27% 유의적으로 감소하였다. 이것은 단일추출물 CEE 100 μg/mL 첨가군과 비교하였을 때, 약 1.6배 더 효과적으로 cell viability가 낮아진 것을 확인할 수 있었다. 또한 200 μg/mL 농도 첨가군 중 가장 효과가 좋았던 단일추출물 AGE와 1:1:1 혼합물의 동일 농도첨가군을 비교할 때 약 1.5배, AGE 500 μg/mL 농도에서 1.2배 효과적인 cell viability의 감소를 확인하였다. 그러나 1,000 μg/mL 농도에서는 cell viability가 약 49.77%로 단일추출물 AGE의 동일농도에서 보다 높은 cell viability(32.42%)를 나타내었다.

Fig. 1. Effects of Cervus elaphus antler 50% ethanol extract (CEE), Glycyrrhiza uralensis 50% ethanol extract (GUE), Angelica gigas 50% ethanol extract (AGE) or their combination in various ratios including CGA113 on cell viability of BPH-1 cells. All data are expressed as mean±SD; (n=10). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

전립선 세포증식 억제를 위한 다양한 추출물 비율로 실험을 진행하였으며 Fig. 1과 같이 CEE, GUE, AGE를 1:1:3 비율로 한 복합추출물 CGA113에서 가장 효과적인 결과를 얻을 수 있었다. CGA113은 200 μg/mL에서 control 대비 38.58%, 500 μg/mL에서 61.10%, 1,000 μg/mL에서 95.65% 억제하여 가장 효과적이었던 단일 추출물과 비교하였을 때, 세포증식 억제율을 최대 72.03% 증가(1,000 μg/mL)시켰으며 농도 의존적으로 세포증식을 억제한 것으로 확인되었다(P<0.05). CGA113을 대상으로 0~500 μg/mL 농도를 BPH-1 세포에 처리하고 AR과 SRD5A2의 mRNA 발현을 확인하였다(Fig. 2). AR은 500 μg/mL에서 42.43% 유의적으로 발현이 감소하였고, SRD5A2는 500 μg/mL에서 23.99% 유의적인 감소를 나타내는 등 모든 농도에서 유의적인 감소를 나타냈다(P<0.05).

Fig. 2. Effects of CGA113 on mRNA expression levels of AR and SRD5A2 in BPH-1 cells. Quantitative real-time PCR was performed for examination of inhibitory effect of CGA113 on (A) AR and (B) SRD5A2 mRNA levels. All data are expressed as mean±SD; (n=10). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

전립선 조직 내 세포증식과 apoptosis의 불균형은 BPH의 주요한 특징이며(Quiles 등, 2010), AR은 DHT와 결합하여 활성화되어 전립선 세포증식을 촉진한다(Liu 등, 2019). T를 DHT로 전환시키는 5α-reductase의 활성 증가는 EGF, FGF 등 성장인자와 관련된 AR-target gene의 발현을 증가시키기 때문에 BPH를 발달시키는 요인이 될 수 있으며(Bartsch 등, 2000), 5α-reductase family의 isozymes 중 5α-reductase type2(SRD5A2)는 전립선 조직에서 높은 수준으로 발현하여, BPH의 위중도와 양의 상관관계가 있는 것으로 보고되었다(Nikolaou 등, 2021). 본 연구의 in vitro 실험에서 CGA113은 BPH-1 세포증식을 억제하고, AR과 SRD5A2를 mRNA 수준에서 감소시켰다. 선행 연구에 따르면 감초의 플라보노이드 성분인 liquiritin과 당귀의 decursin 성분이 세포주기조절 기전을 통해 세포의 증식을 막는 한편(Wang 등, 2020; Kim 등, 2021), 감초 및 당귀가 포함된 복합물인 YSTE 또한 BPH-1의 세포증식을 억제한다고 보고되었다(Park 등, 2016). 본 실험에 사용된 녹용, 감초, 당귀 복합물인 CGA113도 추출물에 포함된 감초 및 당귀의 활성성분이 BPH-1 세포증식을 억제하고 나아가 AR 및 SRD5A2의 발현을 저해한 것으로 보인다.

전립선비대 유도 동물모델에서 CGA113 투여에 따른 조직학적 변화 및 전립선 무게 변화

CGA113을 대상으로 in vivo 효과를 검토하기 위하여 전립선비대 유도 동물모델에서 50, 200 mg/kg BW의 CGA113을 총 8주간 경구투여 하였으며, 희생 후 전립선을 수집하고 H&E 분석을 통해 조직학적 변화를 비교하였다(Fig. 3). 대조군(control)과 비교하여 전립선비대 유도된 BPH군의 경우 내강이 좁아지고 상피세포가 비후된 것을 볼 수 있었다. 반면, CGA113-L군과 CGA113-H군은 BPH군과 비교할 때 농도의존적으로 내강의 변화와 상피세포 비후도가 낮았으며 특히 CGA113-H군의 경우 대조군과 유사하였다.

Fig. 3. Histopathological examination in prostate tissues of rats. H&E staining of prostate was performed from control and BPH rats administrated with or without CGA113. (A) control: Normal control with 100 μL corn oil injection, (B) BPH: castrated group with.TP (3mg/kg of BW/d) injection, (C) CGA113-L: castrated rats supplied with CGA113 50 mg/kg of BW/d and TP (3mg/kg of BW/d) injection, (D) CGA113-H: castrated rats supplied with CGA113 200 mg/kg of BW/d and TP (3mg/kg of BW/d) injection.

Table 2는 체중 및 전립선 무게 결과이다. 실험동물의 체중 대비 전립선 무게의 비율인 prostate ratio가 BPH군의 경우 대조군 대비 유의적인 상승(89.63%)을 보였으며, CGA113을 경구투여한 경우 고농도군인 CGA113-H군에서 BPH군과 비교하여 19.39% 유의적 감소를 나타냈다(P<0.05). 안전성 지표인 serum AST 및 ALT는 CGA113-L 및 CGA113-H군에서 모두 대조군 대비 유의적인 차이를 보이지 않았다(Table 3).

Table 2 . Prostate weight of rats administered with CGA113

GroupProstate weight (g)Prostate ratio1) (mg/100 g of BW)
Control0.64±0.03b0.12±0.01c
BPH0.98±0.07a0.24±0.02a
CGA113-L0.86±0.04a0.20±0.01ab
CGA113-H0.88±0.06a0.19±0.01b

1)Prostate ratio: prostate weight (mg)/ body weight (mg)×100 (g).

Values are presented as means±SE. Different letters show a significantly difference at P<0.05 as determined by Duncan’s multiple range test. Control: Normal control with 100 μL corn oil injection, BPH: castrated group with TP (3 mg/kg of BW/d) injection, CGA113-L: castrated rats supplied with CGA113 50 mg/kg of BW/d and TP (3 mg/kg of BW/d) injection, CGA113- H: castrated rats supplied with CGA113 200 mg/kg of BW/day and TP (3 mg/kg of BW/d) injection.



Table 3 . The Effects of CGA113 on liver damage in rats

GroupLiver weight ratio1) (%)ALT (U/I)AST (U/I)
Control3.23±0.08a53.50±6.78a97.50±7.78a
BPH3.26±0.08a53.50±4.68a112.40±9.25a
CGA113-L3.37±0.09a57.00±5.12a102.20±7.08a
CGA113-H3.12±0.11a44.70±6.51a112.60±12.64a

1)Liver weight ratio (%): liver weight (g)/ body weight (g)×100.

Values are presented as means±SE. Different letters show a significantly difference at P<0.05 as determined by Duncan’s multiple range test. control: Normal control with 100 μL corn oil injection, BPH: castrated group with TP (3 mg/kg of BW/d) injection, CGA113-L: castrated rats supplied with CGA113 50 mg/kg of BW/d and TP (3 mg/kg of BW/d) injection, CGA113-H: castrated rats supplied with CGA113 200 mg/kg of BW/d and TP (3 mg/kg of BW/d) injection.



전립선비대 유도 동물모델에서 CGA113 투여에 따른 DHT, 5α-reductase1 및 5α-reductase2 level의 변화

전립선비대 유도 동물모델에서 혈액 및 전립선 조직에서의 DHT level의 변화는 Fig. 4와 같다. Serum DHT에서 CGA113-H군의 경우 BPH군 대비 29.98% 유의적으로 감소했으며(Fig. 4A), prostate DHT level 역시 CGA113-H군에서 BPH군 대비 31.44% 유의적 감소를 나타냈다(Fig. 4B; P<0.05). 전립선 조직에서 T를 DHT로 전환하는 SRD5A1 및 SRD5A2 level의 변화는 Fig. 5와 같이 나타났다. BPH군은 대조군대비 유의적으로 SRD5A1, SRD5A2 모두에서 높은 수준을 보였으나(P<0.05), CGA113 투여군 중 CGA113-H군의 경우 SRD5A2에서 BPH군 대비 유의적으로 41.63% 낮은 수준을 보였다(P<0.05).

Fig. 4. Effect of CGA113 on DHT level in serum and prostate of rats. (A) Serum DHT level in rats, (B) DHT level in rat prostate tissues. All data are expressed as mean±SE (n=8). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

Fig. 5. Effect of CGA113 on 5α-reductase1 and 5α-reductase2 level in rat prostate. ELISA assay of (A) SRD5A1 and (B) SRD5A2 level in prostate of rats. All data are expressed as mean±SE (n=8). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

DHT는 AR에 대한 강력한 친화력으로 인해 BPH 발달에 매우 중요하다(Izumi 등, 2013). T를 DHT로 전환하는 5α-reductase의 효소의 작용으로 인해 T가 감소하는 노년기 남성에서도 DHT는 높은 상태로 유지되는 경향을 보인다(Bartsch 등, 2000). 5α-Reductase type 1은 주로 간과 피부에 발현하고 5α-reductase type 2는 주로 전립선에 발현한다(Steers, 2001). 본 실험에서 CGA113-H는 혈청 및 조직 DHT의 수준을 감소시키고 전립선 조직 내 5α-reductase2 발현을 mRNA 수준에서 억제하였다. Tang의 연구에서 녹용(Cervus nippon) 추출물이 전립선암 xenograft 모델의 수컷 BALB/c 마우스 혈청 DHT와 T 수준을 감소시켰으며(Tang 등, 2019), 또 다른 연구에서는 in vitroin vivo BPH 모델에서 감초의 플라보노이드 성분인 liquiritin이 함유된 전통 한약재 PSWE의 BPH 억제 효능이 보고되었다(Park 등, 2018).

전립선비대 유도 동물모델에서 CGA113 투여에 따른 Bax, Bcl2 mRNA 발현변화

Fig. 6은 전립선비대 유도 동물모델의 전립선 조직에서 BaxBcl2의 mRNA 발현 변화이다. Bax의 mRNA 발현은 CGA113-H에서 유의적으로 증가하였으나(Fig. 6A) Bcl2 mRNA 발현은 유의적인 차이가 없었다(Fig. 6B). 그러나 Bax/Bcl2 ratio에서 control 대비 BPH가 65.10% 감소한 반면, CGA113-H에서 32.65% 유의적인 증가를 나타냈다(Fig. 6C; P<0.05).

Fig. 6. Effect of CGA113 on mRNA expression levels of Bax, Bcl2 level, and Bax/Bcl-2 ratio in rat prostate. qPCR analysis of (A) Bax, (B) Bcl2, and (C) Bax/Bcl2 ratio in prostate tissues of rats supplemented by CGA113. All data are expressed as mean±SE (n=8). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

B 세포 림프종 2(Bcl2) 및 Bcl-2 관련 X 단백질(Bax)은 미토콘드리아 apoptosis 경로를 내재적으로 제어한다(Edlich, 2018). 감초의 플라보노이드 성분인 liquiritin, isoliquiritin 및 isoliquirigenin은 apoptosis를 유도하여 Bcl-2 발현을 감소시킨다고 보고되었으며(Zhou와 Ho, 2014), 당귀에서 분리한 decursin 또한 Bcl-2의 발현을 감소시키는 동시에 p38의 인산화와 Bax의 발현을 증가시킨다고 보고되었다(Kim 등, 2015). 본 연구에서도 감초 및 당귀를 포함한 복합물인 CGA113이 Bax 발현과 Bax/Bcl2 ratio를 유의적으로 증가시킨 것을 확인하였다. CGA113에 포함된 decursin 및 플라보노이드 성분은 BPH 조직 내 세포증식을 막고 apoptosis의 유도를 통해 BPH 발달을 효과적으로 억제한 것으로 보인다.

본 연구에서는 녹용(Cervus elaphus antler), 감초(Glycyrrhiza uralensis), 당귀(Angelica gigas) 복합물 CGA113의 BPH 억제 효능을 평가하기 위하여 BPH-1 세포 및 전립선비대를 유발한 SD rat를 이용해 BPH 억제기전 및 효과를 검토하였다. CGA113은 BPH-1 세포의 cell viability를 단일추출물 대비 최대 약 1.9배 더 효과적으로 감소시켜 복합추출물의 상승효과를 보여주었으며, BPH-1 세포의 AR 및 SRD5A2의 mRNA 발현 또한 모든 농도에서 유의적으로 감소시켰다. 다음으로 전립선비대를 유도한 SD rat에게 8주간 CGA113(50, 200 mg/kg)을 경구투여한 결과, 200 mg/kg CGA113을 처리한 군(CGA113-H)의 prostate ratio, serum DHT 및 prostate DHT, prostate 5α-reductase2가 BPH군과 비교하여 유의적으로 감소한 것을 확인할 수 있었다. 또한 CGA113을 투여한 동물의 전립선 조직을 H&E 염색하여 조직학적으로 관찰한 결과, BPH군과 비교하여 전립선 상피세포의 비후가 감소하고 내강이 확장된 것을 알 수 있었다. CGA113-H의 전립선 조직 내 Bax 단백질의 mRNA 수준 발현은 BPH군보다 유의적으로 증가하였고, Bax/Bcl2 ratio 또한 유의적으로 증가하였다. 이는 CGA 113에 포함된 녹용, 감초, 당귀의 다양한 활성 물질(liquiritin, decursin 등)의 개별 효과와 더불어 복합물의 시너지효과로 사료된다. 따라서 CGA113의 단일한 성분과 기전을 규명하고 추가적인 실험이 수행된다면 CGA113이 BPH 발달 억제 및 조절에 효과적인 대안이 될 수 있을 것으로 판단된다.

  1. Bartsch G, Rittmaster RS, Klocker H. Dihydrotestosterone and the concept of 5α-reductase inhibition in human benign prostatic hyperplasia. Eur Urol. 2000. 37:367-380.
    Pubmed CrossRef
  2. Bode AM, Dong Z. Toxic phytochemicals and their potential risks for human cancer. Cancer Prev Res (Phila). 2015. 8:1-8.
    Pubmed KoreaMed CrossRef
  3. Carson Ⅲ C, Rittmaster R. The role of dihydrotestosterone in benign prostatic hyperplasia. Urology. 2003. 61(4 Suppl 1):2-7.
    CrossRef
  4. Chen JC, Hsiang CY, Lin YC, Ho TY. Deer antler extract improves fatigue effect through altering the expression of genes related to muscle strength in skeletal muscle of mice. Evid Based Complement Altern Med. 2014. Article ID 540580. https://doi.org/10.1155/2014/540580
    Pubmed KoreaMed CrossRef
  5. Cicero AFG, Allkanjari O, Busetto GM, Cai T, Larganà G, Magri V, et al. Nutraceutical treatment and prevention of benign prostatic hyperplasia and prostate cancer. Arch Ital Urol Androl. 2019. 91:139-152.
    Pubmed CrossRef
  6. Deslypere JP, Young M, Wilson JD, McPhaul MJ. Testosterone and 5α-dihydrotestosterone interact differently with the androgen receptor to enhance transcription of the MMTV-CAT reporter gene. Mol Cell Endocrinol. 1992. 88:15-22. https:// doi.org/10.1016/0303-7207(92)90004-P
    CrossRef
  7. Edlich F. BCL-2 proteins and apoptosis: Recent insights and unknowns. Biochem Biophys Res Commun. 2018. 500:26-34.
    Pubmed CrossRef
  8. Fertig RM, Gamret AC, Darwin E, Gaudi S. Sexual side effects of 5-α-reductase inhibitors finasteride and dutasteride: A comprehensive review. Dermatol Online J. 2017. 23:3. https://doi.org/10.5070/d32311037240
    Pubmed CrossRef
  9. Izumi K, Mizokami A, Lin WJ, Lai KP, Chang C. Androgen receptor roles in the development of benign prostate hyperplasia. Am J Pathol. 2013. 182:194P<1949.
    Pubmed KoreaMed CrossRef
  10. Jiang C, Lee HJ, Li GX, Guo J, Malewicz B, Zhao Y, et al. Potent antiandrogen and androgen receptor activities of an Angelica gigas-containing herbal formulation: Identification of decursin as a novel and active compound with implications for prevention and treatment of prostate cancer. Cancer Res. 2006. 66:453-463.
    Pubmed CrossRef
  11. Juckett DA. What determines age-related disease: do we know all the right questions?. Age. 2010. 32:155-160.
    Pubmed KoreaMed CrossRef
  12. Kim BS, Seo H, Kim HJ, Bae SM, Son HN, Lee YJ, et al. Decursin from Angelica gigas Nakai inhibits B16F10 melanoma growth through induction of apoptosis. J Med Food. 2015. 18:1121-1127.
    Pubmed KoreaMed CrossRef
  13. Kim S, Lee SI, Kim N, Joo M, Lee KH, Lee MW, et al. Decursin inhibits cell growth and autophagic flux in gastric cancer via suppression of cathepsin C. Am J Cancer Res. 2021. 11:1304- 1320.
  14. Liu J, Fang T, Li M, Song Y, Li J, Xue Z, et al. Pao pereira extract attenuates testosterone-induced benign prostatic hyperplasia in rats by inhibiting 5α-reductase. Sci Rep. 2019. 9:19703. https://doi.org/10.1038/s41598-019-56145-z
    Pubmed KoreaMed CrossRef
  15. Nikolaou N, Hodson L, Tomlinson JW. The role of 5-reduction in physiology and metabolic disease: evidence from cellular, pre-clinical and human studies. J Steroid Biochem Mol Biol. 2021. 207:105808. https://doi.org/10.1016/J.JSBMB.2021.105808
    Pubmed CrossRef
  16. Park E, Lee MY, Jeon WY, Lee N, Seo CS, Shin HK. Inhibitory effect of Yongdamsagan-tang water extract, a traditional herbal formula, on testosterone-induced benign prostatic hyperplasia in rats. Evid Based Complement Altern Med. 2016. Article ID 1428923. https://doi.org/10.1155/2016/1428923
    Pubmed KoreaMed CrossRef
  17. Park E, Lee MY, Jeon WY, Seo CS, You S, Shin HK. Paljung- San, a traditional herbal medicine, attenuates benign prostatic hyperplasia in vitro and in vivo. J Ethnopharmacol. 2018. 218:109-115.
    Pubmed CrossRef
  18. Park HS, Seo CS, Wijerathne CUB, Jeong HY, Moon OS, Seo YW, et al. Effect of Veratrum maackii on testosterone propionate-induced benign prostatic hyperplasia in rats. Biol Pharm Bull. 2019. 42:1-9.
    Pubmed CrossRef
  19. Quiles MT, Arbós MA, Fraga A, de Torres IM, Reventós J, Morote J. Antiproliferative and apoptotic effects of the herbal agent Pygeum africanum on cultured prostate stromal cells from patients with benign prostatic hyperplasia (BPH). Prostate. 2010. 70:1044-1053.
    Pubmed CrossRef
  20. Rim HK, Cho W, Sung SH, Lee KT. Nodakenin suppresses lipopolysaccharide-induced inflammatory responses in macrophage cells by inhibiting tumor necrosis factor receptor-associated factor 6 and nuclear factor-κB pathways and protects mice from lethal endotoxin shock. J Pharmacol Exp Ther. 2012. 342:654-664.
    Pubmed CrossRef
  21. Roehrborn CG. Benign prostatic hyperplasia: An overview. Rev Urol. 2005. 7(Suppl 9):S3-S14.
  22. Roehrborn CG. Pathology of benign prostatic hyperplasia. Int J Impot Res. 2008. 20(Suppl 3):S11-S18.
    Pubmed CrossRef
  23. Sarker SD, Nahar L. Natural medicine: The genus angelica. Curr Med Chem. 2004. 11:1479-1500.
    Pubmed CrossRef
  24. Sowndhararajan K, Kim S. Neuroprotective and cognitive enhancement potentials of Angelica gigas Nakai root: A review. Sci Pharm. 2017. 85:21. https://doi.org/10.3390/scipharm85020021
    Pubmed KoreaMed CrossRef
  25. Steers WD. 5α-reductase activity in the prostate. Urology. 2001. 58(6):17-24.
    CrossRef
  26. Sui Z, Zhang L, Huo Y, Zhang Y. Bioactive components of velvet antlers and their pharmacological properties. J Pharm Biomed Anal. 2014. 87:229-240.
    Pubmed CrossRef
  27. Tang Y, Fan M, Choi YJ, Yu Y, Yao G, Deng Y, et al. Sika deer (Cervus nippon) velvet antler extract attenuates prostate cancer in xenograft model. Biosci Biotechnol Biochem. 2019. 83:348-356.
    Pubmed CrossRef
  28. Vaya J, Belinky PA, Aviram M. Antioxidant constituents from licorice roots: Isolation, structure elucidation and antioxidative capacity toward LDL oxidation. Free Radical Biol Med. 1997. 23:30P<313.
    CrossRef
  29. Wang JR, Li TZ, Wang C, Li SM, Luo YH, Piao XJ, et al. Liquiritin inhibits proliferation and induces apoptosis in HepG2 hepatocellular carcinoma cells via the ROS-mediated MAPK/AKT/NF-κB signaling pathway. Naunyn Schmiedeberg’s Arch Pharmacol. 2020. 393:1987-1999.
    Pubmed CrossRef
  30. Wang ZY, Nixon DW. Licorice and cancer. Nutr Cancer. 2001. 39:1-11.
    Pubmed CrossRef
  31. Wu F, Li H, Jin L, Li X, Ma Y, You J, et al. Deer antler base as a traditional Chinese medicine: A review of its traditional uses, chemistry and pharmacology. J Ethnopharmacol. 2013. 145:403-415.
    Pubmed CrossRef
  32. Zhang J, Li L, Jiang C, Xing C, Kim SH, Lu J. Anti-cancer and other bioactivities of Korean Angelica gigas Nakai (AGN) and its major pyranocoumarin compounds. Anti-Cancer Agents Med Chem. 2012. 12:1239-1254.
    Pubmed CrossRef
  33. Zhang LZ, Xin JL, Zhang XP, Fu Q, Zhang Y, Zhou QL. The anti-osteoporotic effect of velvet antler polypeptides from Cervus elaphus Linnaeus in ovariectomized rats. J Ethnopharmacol. 2013. 150:181-186.
    Pubmed CrossRef
  34. Zhou R, Li S. In vitro antioxidant analysis and characterisation of antler velvet extract. Food Chem. 2009. 114:1321-1327.
    CrossRef
  35. Zhou Y, Ho WS. Combination of liquiritin, isoliquiritin and isoliquirigenin induce apoptotic cell death through upregulating p53 and p21 in the A549 non-small cell lung cancer cells. Oncol Rep. 2014. 31:298-304.
    Pubmed CrossRef

Article

Article

Journal of the Korean Society of Food Science and Nutrition 2022; 51(9): 886-893

Published online September 30, 2022 https://doi.org/10.3746/jkfn.2022.51.9.886

Copyright © The Korean Society of Food Science and Nutrition.

In VitroIn Vivo에서 녹용당귀 등 복합추출물의 전립선비대 억제 효과

이정윤1․손형구1․김소혁1․이기원2․김진수2․김인환2․구영태2․이유현1

1수원대학교 식품영양학과
2광동제약 천연물융합 연구개발본부

Received: July 14, 2022; Revised: July 28, 2022; Accepted: July 28, 2022

The In Vitro and In Vivo Inhibitory Effect of Combined Extracts of Cervus elaphus Antler, Glycyrrhiza uralensis, and Angelica gigas on Benign Prostatic Hyperplasia

Jeong Yoon Lee1 , Hyung Gu Son1, So Hyuk Kim1, Ki Won Lee2, Jin Soo Kim2, In Hwan Kim2, Young Tae Koo2, and Yoo-Hyun Lee1

1Department of Food and Nutrition, The University of Suwon
2Natural Products Convergence R&D Division, Kwangdong Pharm Co., Ltd.

Correspondence to:Yoo-Hyun Lee, Department of Food and Nutrition, College of Health Sciences, University of Suwon, 17, Wauan-gil, Bongdam-eup, Hwasung, Gyeonggi 18323, Korea, E-mail: creamut@suwon.ac.kr

Received: July 14, 2022; Revised: July 28, 2022; Accepted: July 28, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Combinations of natural products have a number of benefits. We investigated the inhibitory effect of a combination of 50% ethanol extracts of Cervus elaphus antler (CEE), Glycyrrhiza uralensis (GUE), and Angelica gigas (AGE) on benign prostatic hyperplasia (BPH) using BPH-1 cells and testosterone propionate (TP)-induced BPH rats. The combination, called CGA113, inhibited cell proliferation by decreasing the cell viability of BPH-1 cells up to 72.03% more than the individual extracts. In addition, CGA113 significantly reduced the mRNA expressions of AR and SRD5A2 in BPH-1 cells. Sprague-Dawley rats were subjected to castration surgery to remove endogenous testosterone, and 3 mg/kg testosterone propionate was subcutaneously injected to induce BPH. Subsequently, CGA113 (50 and 200 mg/kg BW/day) was orally administered to the TP-induced BPH rats for 8 weeks. In the CGA113-H group (200 mg/kg of CGA113), the prostate ratio, serum DHT, prostate DHT, and prostate 5α-reductase2 were significantly decreased compared to the BPH group. Histology with H&E staining of the prostate tissue, revealed a reduction in the thickening of the prostate epithelial cells and enlargement of the lumen compared to the BPH group. The mRNA levels of the Bax/Bcl2 ratio in prostate tissue of the CGA113-H group were significantly increased. Overall, the combined extract of CEE, GUE, and AGE, was determined to exert synergistic effects, indicating the potential of the three natural materials as therapeutic agents for alleviation of BPH symptoms.

Keywords: androgen receptor, Angelica gigas, benign prostatic hyperplasia, Cervus elaphus antler, Glycyrrhiza uralensis

서 론

양성 전립선비대증(BPH)은 중년 남성의 전형적인 배뇨 장애로, 주요 원인은 노화에 따른 성호르몬 변화와 그로 인한 전립선 기질 및 상피세포의 과도한 증식, apoptosis 조절인자의 불균형이다(Carson과 Rittmaster, 2003). 나이가 들수록 남성의 테스토스테론 수치는 감소하지만, 5α-reductase 효소활성은 증가하여 테스토스테론(T)에서 디하이드로테스토스테론(DHT)으로의 전환이 증가한다(Roehrborn, 2008). DHT는 T보다 안드로겐 수용체(AR)와의 약 10배 더 높은 친화력으로 인해 단백질 합성 및 전립선 세포 성장을 촉진한다(Deslypere 등, 1992; Park 등, 2019). BPH는 요도에 가해진 기계적 압박으로 인한 배뇨지연(hesitancy), 요폐(urinary retention), 빈뇨(urinary frequency) 및 요절박(urgency) 등의 다양한 하부요로증상(LUTS)을 동반하여(Roehrborn, 2005), 노년기 삶의 질을 떨어뜨린다. 현대사회는 평균 수명 연장으로 인하여 이러한 연령 관련 질병 치료의 중요성이 강조되고 있다(Juckett, 2010). BPH치료 약물로 가장 널리 사용되는 finasteride 및 dutasteride는 5α-redcuctase 활성 억제를 통해 DHT의 수준을 낮추고 BPH 증상을 완화하지만, 발기부전, 성욕 감소와 같은 성기능 장애 및 다양한 부작용이 보고되고 있다(Fertig 등, 2017). 따라서 최근 BPH 치료제 시장은 부작용이 적고 효능과 안전성을 갖춘 천연물 소재의 기능성 식품에 관심이 집중되고 있다(Cicero 등, 2019).

녹용(Cervus elaphus antler)은 면역 체계, 건강 증진 및 성 기능에 대한 다양한 약리학적 효과로 인해 2천 년 이상 사용되어 왔다(Sui 등, 2014). 녹용의 uronic acid, sulfated-glycosaminoglycans(sulfated-GAGs), sialic acid 성분은 항암(Wu 등, 2013), 항피로(Chen 등, 2014), 골다공증(Zhang 등, 2013), 항산화(Zhou와 Li, 2009) 효과가 있는 것으로 알려져 있다. 감초(Glycyrrhiza uralensis)는 콩과에 속하는 다년생 초본으로 단맛 성분인 글리시리진 성분을 함유하여 감미료로 사용되며(Bode와 Dong, 2015), 감초의 플라보노이드, 리코칼콘의 성분들은 항암(Wang과 Nixon, 2001), 항산화(Vaya 등, 1997) 등의 효과가 있다. 감초의 주요 폴리페놀 성분인 isoliquirigenin은 apoptosis를 억제하는 인자 Bcl-2를 감소시켜, 전립선 암세포의 apoptosis를 유도하는 것으로 알려졌다(Bode와 Dong, 2015). 당귀(Angelica gigas)는 한국 및 중국 등지에서 서식하는 다년생 식물로 건조된 뿌리를 감기, 통증 및 빈혈 치료를 위한 약재로 사용해 왔으며(Sarker와 Nahar, 2004), 당귀의 주요 활성 성분이며 쿠마린 유도체로 알려진 데커신(decursin), nodakenin, decursinol은 신경 보호 효과(Sowndhararajan과 Kim, 2017), 항염(Rim 등, 2012), 항암 효과(Zhang 등, 2012), 항안드로겐 효과 및 안드로겐 수용체 활성을 통한 전립선 암세포의 세포증식 억제 효과(Jiang 등, 2006)가 있는 것으로 보고되고 있다.

최근에는 BPH 증상을 개선하기 위해 천연물 소재 조합을 이용한 다양한 연구가 시도되고 있다. 당귀, 인삼, 백급 등 10가지 한약재로 만들어진 가미계격탕(KMKKT)은 mRNA 및 protein 수준에서 prostatic specific antigen(PSA)을 감소시키고 AR 억제를 통해 항안드로겐 효과를 나타내는 것으로 보고되었으며(Jiang 등, 2006), 또한 치자, 당귀, 황금, 차전자 등을 포함한 용담사간탕(YSTE)은 세포 주기 조절 단백질인 proliferating cell nuclear antigen(PCNA)의 감소에 의한 항증식 활성 조절을 통해 BPH 발달을 억제하고 malondialdehyde(MDA) 함량을 낮추어 항산화 효소 활성을 억제하는 것으로 보고되었다(Park 등, 2016). 이 연구에서 각 한약재의 단일 추출물이 전립선 상피세포주인 BPH-1 세포의 증식을 효과적으로 억제할 수 있으며 특히 혼합물을 이용하는 경우 억제 효능이 유의적으로 증가하는 것을 확인하였다. 일반적으로 천연물 추출물의 조합은 단일추출물에 비해 기존의 효능을 증가시키거나 상승효과를 나타낸다. 따라서 본 연구에서는 녹용, 당귀 및 감초를 포함한 복합추출물의 상승효과를 검토하기 위하여 단일추출물과 다양한 비율의 혼합물을 이용하여 세포증식 억제율을 비교하였고, 가장 효과적인 배합의 복합추출물 CGA113을 사용하여 BPH에 대한 효과를 검토하였다.

재료 및 방법

시료의 제조

본 실험에 사용된 녹용추출물(C. elaphus antler 50% ethanol extract; CEE), 감초추출물(G. uralensis 50% ethanol extract; GUE), 당귀추출물(A. gigas 50% ethanol extract; AGE), 및 복합추출물(CGA113)은 다음과 같이 제조되었다. 단일추출물인 CEE, GUE, AGE는 각각 녹용, 감초, 당귀를 50% 주정으로 1차 추출 및 2차 추출 후 농축하여 건조한 시료를 사용하였으며, 복합 추출물인 CGA113은 녹용, 감초, 당귀를 1:1:3 비율로 계량 후, 단일추출물과 동일한 방법으로 1차 및 2차 추출한 시료를 사용하였다. 본 시료들은 광동제약(Seoul, Korea)에서 제공받아 사용하였다.

세포 배양

본 연구는 인간 전립선비대 상피세포주인 BPH-1 세포(DSMZ, Braunschweig, Germany)를 사용하여 진행하였다. 세포는 37°C, 5% CO2의 환경에서 20% FBS, 1% antibiotic antimycotic solution, 20 ng/mL testosterone, 5 μg/mL transferrin, 5 ng/mL sodium selenite, 5 μg/mL insulin을 추가한 RPMI 1640 배지를 사용하여 배양되었다.

Cell viability

CEE, GUE, AGE 등의 단일추출물, 1:1:1 복합추출물 및 CGA113이 BPH-1 cell의 세포증식에 미치는 영향을 확인하기 위하여 MTT assay를 실시하였다. BPH-1 cell을 96 well plate(1×104 cell/well)에 seeding 하고 37°C, 5% CO2의 환경에서 24시간 동안 배양했다. 그 후에 각 농도(100, 200, 500, 1,000 μg/mL)의 CEE, GUE, AGE, 1:1:1 복합추출물 및 CGA113이 추가된 배지를 100 μL씩 분주하고 48시간 동안 배양하였다. 이후 MTT solution(Sigma-Aldrich Co., St. Louis, MO, USA)을 2 mg/mL의 농도로 각 well당 100 μL씩 분주하고 2시간 동안 배양하였다. 배지를 제거하고 각 well에 DMSO를 100 μL씩 분주한 후 570 nm에서 흡광도를 측정(Epoch, BioTek Instruments, Winooski, VT, USA)하였다.

실험동물

실험동물은 7주령의 수컷 Sprague-Dawley(SD) rats를 중앙실험동물(Seoul, Korea)에서 구매하였다. 1주일의 적응 기간 후에, 온도 22±2°C, 상대습도 55±5%, 명암 주기가 12시간인 환경을 유지하며 사육되었다. 물과 멸균된 사료는 자유롭게 섭취하도록 하였다. 몸무게는 이틀에 1회, 사료 무게는 식이 효율의 측정을 위하여 일주일에 2회 측정하였다. 본 실험은 수원대학교 동물실험윤리위원회의 승인(USW-IACUC-2019-003)을 받아 진행하였다.

실험군 분류 및 시료투여

일주일의 적응 기간을 거친 후 내인성 테스토스테론의 영향을 방지하기 위하여 대조군(control 군)을 제외한 모든 군을 대상으로 중성화 수술을 하였다. 각 군은 8마리로 설정하였으며 BPH의 유도를 위해 Testosterone propionate(TP)를 3 mg/kg의 농도로 corn oil에 녹여 0.1 mL씩 8주간 매일 피하주사하였고, sample 투여군은 증류수에 녹인 CGA113을 존대(Zonde)를 이용하여 8주간 경구투여를 진행하였다. 실험군은 다음과 같다. (1) control 군: corn oil을 피하주사하고 식염수를 경구투여한 군, (2) BPH 군: TP(3 mg/kg of BW/d)를 피하주사하고 식염수를 경구투여한 군, (3) CGA113-L 군: TP(3 mg/kg of BW/d)를 피하주사하고 CGA113(50 mg/kg)을 경구투여한 군, (4) CGA113-H 군: TP(3 mg/kg of BW/d)를 피하주사하고 CGA113(200 mg/kg)을 경구투여한 군.

Serum의 분리 및 장기 무게 측정

실험동물은 희생 전 12시간 동안 금식을 진행하였으며 CO2 chamber를 사용하여 희생하였다. 희생한 rat에서 혈액 및 간, 전립선을 채취하였으며 장기들의 무게를 측정하였다. 혈액은 serum 분리를 위해 20분간 3,000 rpm에서 원심분리(MF-80, Hanil Science industrial, Incheon, Korea)하여 DHT, alanine aminotransferase(ALT), aspartate aminotransferase(AST) 측정에 사용되었으며, 수집된 장기들은 phosphate buffered saline(PBS, pH7.4)에서 세척하여 -80°C에 보관 후 5α-reductase1(SRD5A1), 5α-reductase2(SRD5A2), B-cell lymphoma-2(Bcl-2) 및 Bcl-2-associated X protein(Bax) 측정에 사용되었다.

ALT, AST 측정

간 손상의 정도를 판단하는 지표인 ALT 및 AST는 건식 화학 분석기(FUJI DRI CHEM 500i, FUJI photo film Co., Ltd, Tokyo, Japan)와 건식 화학 분석기 전용 FUJI DRI-CHEM SLIDE kit(FUJI photo film Co., Ltd)을 사용하여 혈청에서의 수준을 측정하였다.

조직학적 분석

조직학적 분석을 수행하기 위해 전립선 조직을 10% formaldehyde에 고정시킨 후 탈수하여 paraffin에 포매하였다. Paraffin에 포매된 전립선 조직은 2 μm 두께로 절단하여 Hematoxyline & Eosin(H&E)으로 염색을 시행한 후 커버 글라스로 덮어 광학 현미경으로 100배 확대하여 전립선 조직을 평가하였다.

Enzyme-linked immunosorbent assay(ELISA)

전립선 조직 100 mg당 1×PBS(pH 7.4)를 1 mL 가하여 균질화를 진행하고 5,000×g, 4°C에서 5분간 원심분리하여 상등액을 채취하였다. 이후 전립선 조직 및 혈청 내 DHT, 5α-reductase1 및 5α-reductase2 수준을 측정하기 위하여 DHT, SRD5A1 및 SRD5A2 ELISA kit(Cusabio, Wuhan, China)을 사용하여 제조업체의 지침에 따라 450 nm의 흡광도에서 Epoch Microplate Spectrophotometer(BioTek Instruments)를 사용하여 측정하였다. 측정된 흡광도 값은 Curve Expert 1.3(Hyams Development)을 사용하여 계산하였다.

Quantitative real time polymerase-chain reaction (qRT-PCR)

BPH-1 cell 및 실험동물의 전립선 조직에서 BPH와 관련한 gene의 mRNA 발현에 CGA113이 미치는 영향을 알아보기 위하여 qPCR을 진행하였다. BPH-1 cell은 24 well plate(5×104 cell/well)에서 CGA113이 100~500 μg/mL의 농도로 첨가된 배지에 24시간 배양된 후 RNA 추출하였으며, 실험동물의 경우 전립선 조직을 약 50 mg 균질화하여 RNA 추출하였다. 모두 RNAiso(TaKaRa, Kusatsu, Japan)를 이용하여 RNA를 추출한 뒤, T100 Thermal Cycler(Bio-Rad, Hercules, CA, USA)를 사용하여 cDNA로 합성되었다. qPCR은 HiPi Real-Time PCR 2× Master Mix(ELPIS, Daejeon, Korea)를 사용하여 Light Cycler 96(Roche, Basel, Switzerland)으로 수행하였으며, GAPDH를 internal control로 사용하여 AR의 수준을 확인하였다. qPCR은 95°C에서 10분간 preincubation하고, 95°C에서 10초, 55°C 10초, 72°C에서 10초의 순서로 총 40회 반복한 후, 95°C 5초, 65°C 60초의 Melting curve analysis와 37°C 30초의 cooling time을 가졌다. 본 실험에서 Real-time qPCR 수행을 위해 사용된 primer의 염기서열은 Table 1과 같다.

Table 1 . Primers used for quantitative real time PCR.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
Human
GAPDHAGCCTTCTCCATGGTGGTGAAGACCGGAGTGAACGGATTTGGTCGTAT
SRD5A2CTACGGGAAGCACACGGAGAGCCTGAACCAGGCTTCCTGAGCTGGCGCAATATATAG
ARAGCACCATGCAACTCCTTCAGCACCGACACTGCCTTACACAA
Rat
GAPDHTGGAAGGACTCATGACCACATTCAGGTCAGGGATGACCTT
BaxCCAGGACGCATCCACCAAGAAGCTGCCACACGGAAGAAGACCTCTCG
Bcl2GAGGCTGGGATGCCTTTGTGGAGCTGAGCAGCGTCTTCAGAGA


통계분석

In vitro의 결과는 mean±standard deviation(SD), in vivo의 결과는 mean±standard error(SE)로 표기하였으며 통계의 처리는 SPSS(Ver. 20, IBM Corporation, Armonk, NY, USA) 프로그램을 사용하였다. 실험군 간의 차이는 일원배치 분산분석(One-way ANOVA)과 Duncan’s multiple range tests의 사후 검증을 실시하여, 각 군의 유의성 검정을 통해 확인하였다(P<0.05).

결과 및 고찰

CGA113과 단일추출물 및 혼합물의 in vitro 전립선 세포증식 억제 효과 비교

Fig. 1은 전립선비대세포인 BPH-1에서 녹용, 당귀, 감초의 50% 에탄올 추출물인 CEE, GUE, AGE와 각 추출물을 1:1:1 비율로 혼합한 것 그리고 복합추출물인 CGA113의 세포증식 억제 효과를 확인한 결과이다. 단일 혹은 복합추출물은 100~1,000 μg/mL까지의 다양한 농도에서 모두 유의적으로 세포증식을 억제하였다. 단일추출물의 경우 AGE처리군에서 농도 의존적으로 감소하였으며, 1,000 μg/mL에서 67.58%까지 유의적으로 억제하였다. 단일추출물들 조합의 상승효과를 검토하기 위하여 CEE, GUE, AGE를 1:1:1 비율로 혼합하여 처리한 후 cell viability를 확인하였다. 무첨가군에 해당하는 0 μg/mL 농도의 cell viability를 100%라고 할 때 1:1:1 혼합물 100 μg/mL 농도에서 약 33.27% 유의적으로 감소하였다. 이것은 단일추출물 CEE 100 μg/mL 첨가군과 비교하였을 때, 약 1.6배 더 효과적으로 cell viability가 낮아진 것을 확인할 수 있었다. 또한 200 μg/mL 농도 첨가군 중 가장 효과가 좋았던 단일추출물 AGE와 1:1:1 혼합물의 동일 농도첨가군을 비교할 때 약 1.5배, AGE 500 μg/mL 농도에서 1.2배 효과적인 cell viability의 감소를 확인하였다. 그러나 1,000 μg/mL 농도에서는 cell viability가 약 49.77%로 단일추출물 AGE의 동일농도에서 보다 높은 cell viability(32.42%)를 나타내었다.

Fig 1. Effects of Cervus elaphus antler 50% ethanol extract (CEE), Glycyrrhiza uralensis 50% ethanol extract (GUE), Angelica gigas 50% ethanol extract (AGE) or their combination in various ratios including CGA113 on cell viability of BPH-1 cells. All data are expressed as mean±SD; (n=10). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

전립선 세포증식 억제를 위한 다양한 추출물 비율로 실험을 진행하였으며 Fig. 1과 같이 CEE, GUE, AGE를 1:1:3 비율로 한 복합추출물 CGA113에서 가장 효과적인 결과를 얻을 수 있었다. CGA113은 200 μg/mL에서 control 대비 38.58%, 500 μg/mL에서 61.10%, 1,000 μg/mL에서 95.65% 억제하여 가장 효과적이었던 단일 추출물과 비교하였을 때, 세포증식 억제율을 최대 72.03% 증가(1,000 μg/mL)시켰으며 농도 의존적으로 세포증식을 억제한 것으로 확인되었다(P<0.05). CGA113을 대상으로 0~500 μg/mL 농도를 BPH-1 세포에 처리하고 AR과 SRD5A2의 mRNA 발현을 확인하였다(Fig. 2). AR은 500 μg/mL에서 42.43% 유의적으로 발현이 감소하였고, SRD5A2는 500 μg/mL에서 23.99% 유의적인 감소를 나타내는 등 모든 농도에서 유의적인 감소를 나타냈다(P<0.05).

Fig 2. Effects of CGA113 on mRNA expression levels of AR and SRD5A2 in BPH-1 cells. Quantitative real-time PCR was performed for examination of inhibitory effect of CGA113 on (A) AR and (B) SRD5A2 mRNA levels. All data are expressed as mean±SD; (n=10). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

전립선 조직 내 세포증식과 apoptosis의 불균형은 BPH의 주요한 특징이며(Quiles 등, 2010), AR은 DHT와 결합하여 활성화되어 전립선 세포증식을 촉진한다(Liu 등, 2019). T를 DHT로 전환시키는 5α-reductase의 활성 증가는 EGF, FGF 등 성장인자와 관련된 AR-target gene의 발현을 증가시키기 때문에 BPH를 발달시키는 요인이 될 수 있으며(Bartsch 등, 2000), 5α-reductase family의 isozymes 중 5α-reductase type2(SRD5A2)는 전립선 조직에서 높은 수준으로 발현하여, BPH의 위중도와 양의 상관관계가 있는 것으로 보고되었다(Nikolaou 등, 2021). 본 연구의 in vitro 실험에서 CGA113은 BPH-1 세포증식을 억제하고, AR과 SRD5A2를 mRNA 수준에서 감소시켰다. 선행 연구에 따르면 감초의 플라보노이드 성분인 liquiritin과 당귀의 decursin 성분이 세포주기조절 기전을 통해 세포의 증식을 막는 한편(Wang 등, 2020; Kim 등, 2021), 감초 및 당귀가 포함된 복합물인 YSTE 또한 BPH-1의 세포증식을 억제한다고 보고되었다(Park 등, 2016). 본 실험에 사용된 녹용, 감초, 당귀 복합물인 CGA113도 추출물에 포함된 감초 및 당귀의 활성성분이 BPH-1 세포증식을 억제하고 나아가 AR 및 SRD5A2의 발현을 저해한 것으로 보인다.

전립선비대 유도 동물모델에서 CGA113 투여에 따른 조직학적 변화 및 전립선 무게 변화

CGA113을 대상으로 in vivo 효과를 검토하기 위하여 전립선비대 유도 동물모델에서 50, 200 mg/kg BW의 CGA113을 총 8주간 경구투여 하였으며, 희생 후 전립선을 수집하고 H&E 분석을 통해 조직학적 변화를 비교하였다(Fig. 3). 대조군(control)과 비교하여 전립선비대 유도된 BPH군의 경우 내강이 좁아지고 상피세포가 비후된 것을 볼 수 있었다. 반면, CGA113-L군과 CGA113-H군은 BPH군과 비교할 때 농도의존적으로 내강의 변화와 상피세포 비후도가 낮았으며 특히 CGA113-H군의 경우 대조군과 유사하였다.

Fig 3. Histopathological examination in prostate tissues of rats. H&E staining of prostate was performed from control and BPH rats administrated with or without CGA113. (A) control: Normal control with 100 μL corn oil injection, (B) BPH: castrated group with.TP (3mg/kg of BW/d) injection, (C) CGA113-L: castrated rats supplied with CGA113 50 mg/kg of BW/d and TP (3mg/kg of BW/d) injection, (D) CGA113-H: castrated rats supplied with CGA113 200 mg/kg of BW/d and TP (3mg/kg of BW/d) injection.

Table 2는 체중 및 전립선 무게 결과이다. 실험동물의 체중 대비 전립선 무게의 비율인 prostate ratio가 BPH군의 경우 대조군 대비 유의적인 상승(89.63%)을 보였으며, CGA113을 경구투여한 경우 고농도군인 CGA113-H군에서 BPH군과 비교하여 19.39% 유의적 감소를 나타냈다(P<0.05). 안전성 지표인 serum AST 및 ALT는 CGA113-L 및 CGA113-H군에서 모두 대조군 대비 유의적인 차이를 보이지 않았다(Table 3).

Table 2 . Prostate weight of rats administered with CGA113.

GroupProstate weight (g)Prostate ratio1) (mg/100 g of BW)
Control0.64±0.03b0.12±0.01c
BPH0.98±0.07a0.24±0.02a
CGA113-L0.86±0.04a0.20±0.01ab
CGA113-H0.88±0.06a0.19±0.01b

1)Prostate ratio: prostate weight (mg)/ body weight (mg)×100 (g)..

Values are presented as means±SE. Different letters show a significantly difference at P<0.05 as determined by Duncan’s multiple range test. Control: Normal control with 100 μL corn oil injection, BPH: castrated group with TP (3 mg/kg of BW/d) injection, CGA113-L: castrated rats supplied with CGA113 50 mg/kg of BW/d and TP (3 mg/kg of BW/d) injection, CGA113- H: castrated rats supplied with CGA113 200 mg/kg of BW/day and TP (3 mg/kg of BW/d) injection..



Table 3 . The Effects of CGA113 on liver damage in rats.

GroupLiver weight ratio1) (%)ALT (U/I)AST (U/I)
Control3.23±0.08a53.50±6.78a97.50±7.78a
BPH3.26±0.08a53.50±4.68a112.40±9.25a
CGA113-L3.37±0.09a57.00±5.12a102.20±7.08a
CGA113-H3.12±0.11a44.70±6.51a112.60±12.64a

1)Liver weight ratio (%): liver weight (g)/ body weight (g)×100..

Values are presented as means±SE. Different letters show a significantly difference at P<0.05 as determined by Duncan’s multiple range test. control: Normal control with 100 μL corn oil injection, BPH: castrated group with TP (3 mg/kg of BW/d) injection, CGA113-L: castrated rats supplied with CGA113 50 mg/kg of BW/d and TP (3 mg/kg of BW/d) injection, CGA113-H: castrated rats supplied with CGA113 200 mg/kg of BW/d and TP (3 mg/kg of BW/d) injection..



전립선비대 유도 동물모델에서 CGA113 투여에 따른 DHT, 5α-reductase1 및 5α-reductase2 level의 변화

전립선비대 유도 동물모델에서 혈액 및 전립선 조직에서의 DHT level의 변화는 Fig. 4와 같다. Serum DHT에서 CGA113-H군의 경우 BPH군 대비 29.98% 유의적으로 감소했으며(Fig. 4A), prostate DHT level 역시 CGA113-H군에서 BPH군 대비 31.44% 유의적 감소를 나타냈다(Fig. 4B; P<0.05). 전립선 조직에서 T를 DHT로 전환하는 SRD5A1 및 SRD5A2 level의 변화는 Fig. 5와 같이 나타났다. BPH군은 대조군대비 유의적으로 SRD5A1, SRD5A2 모두에서 높은 수준을 보였으나(P<0.05), CGA113 투여군 중 CGA113-H군의 경우 SRD5A2에서 BPH군 대비 유의적으로 41.63% 낮은 수준을 보였다(P<0.05).

Fig 4. Effect of CGA113 on DHT level in serum and prostate of rats. (A) Serum DHT level in rats, (B) DHT level in rat prostate tissues. All data are expressed as mean±SE (n=8). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

Fig 5. Effect of CGA113 on 5α-reductase1 and 5α-reductase2 level in rat prostate. ELISA assay of (A) SRD5A1 and (B) SRD5A2 level in prostate of rats. All data are expressed as mean±SE (n=8). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

DHT는 AR에 대한 강력한 친화력으로 인해 BPH 발달에 매우 중요하다(Izumi 등, 2013). T를 DHT로 전환하는 5α-reductase의 효소의 작용으로 인해 T가 감소하는 노년기 남성에서도 DHT는 높은 상태로 유지되는 경향을 보인다(Bartsch 등, 2000). 5α-Reductase type 1은 주로 간과 피부에 발현하고 5α-reductase type 2는 주로 전립선에 발현한다(Steers, 2001). 본 실험에서 CGA113-H는 혈청 및 조직 DHT의 수준을 감소시키고 전립선 조직 내 5α-reductase2 발현을 mRNA 수준에서 억제하였다. Tang의 연구에서 녹용(Cervus nippon) 추출물이 전립선암 xenograft 모델의 수컷 BALB/c 마우스 혈청 DHT와 T 수준을 감소시켰으며(Tang 등, 2019), 또 다른 연구에서는 in vitroin vivo BPH 모델에서 감초의 플라보노이드 성분인 liquiritin이 함유된 전통 한약재 PSWE의 BPH 억제 효능이 보고되었다(Park 등, 2018).

전립선비대 유도 동물모델에서 CGA113 투여에 따른 Bax, Bcl2 mRNA 발현변화

Fig. 6은 전립선비대 유도 동물모델의 전립선 조직에서 BaxBcl2의 mRNA 발현 변화이다. Bax의 mRNA 발현은 CGA113-H에서 유의적으로 증가하였으나(Fig. 6A) Bcl2 mRNA 발현은 유의적인 차이가 없었다(Fig. 6B). 그러나 Bax/Bcl2 ratio에서 control 대비 BPH가 65.10% 감소한 반면, CGA113-H에서 32.65% 유의적인 증가를 나타냈다(Fig. 6C; P<0.05).

Fig 6. Effect of CGA113 on mRNA expression levels of Bax, Bcl2 level, and Bax/Bcl-2 ratio in rat prostate. qPCR analysis of (A) Bax, (B) Bcl2, and (C) Bax/Bcl2 ratio in prostate tissues of rats supplemented by CGA113. All data are expressed as mean±SE (n=8). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).

B 세포 림프종 2(Bcl2) 및 Bcl-2 관련 X 단백질(Bax)은 미토콘드리아 apoptosis 경로를 내재적으로 제어한다(Edlich, 2018). 감초의 플라보노이드 성분인 liquiritin, isoliquiritin 및 isoliquirigenin은 apoptosis를 유도하여 Bcl-2 발현을 감소시킨다고 보고되었으며(Zhou와 Ho, 2014), 당귀에서 분리한 decursin 또한 Bcl-2의 발현을 감소시키는 동시에 p38의 인산화와 Bax의 발현을 증가시킨다고 보고되었다(Kim 등, 2015). 본 연구에서도 감초 및 당귀를 포함한 복합물인 CGA113이 Bax 발현과 Bax/Bcl2 ratio를 유의적으로 증가시킨 것을 확인하였다. CGA113에 포함된 decursin 및 플라보노이드 성분은 BPH 조직 내 세포증식을 막고 apoptosis의 유도를 통해 BPH 발달을 효과적으로 억제한 것으로 보인다.

요 약

본 연구에서는 녹용(Cervus elaphus antler), 감초(Glycyrrhiza uralensis), 당귀(Angelica gigas) 복합물 CGA113의 BPH 억제 효능을 평가하기 위하여 BPH-1 세포 및 전립선비대를 유발한 SD rat를 이용해 BPH 억제기전 및 효과를 검토하였다. CGA113은 BPH-1 세포의 cell viability를 단일추출물 대비 최대 약 1.9배 더 효과적으로 감소시켜 복합추출물의 상승효과를 보여주었으며, BPH-1 세포의 AR 및 SRD5A2의 mRNA 발현 또한 모든 농도에서 유의적으로 감소시켰다. 다음으로 전립선비대를 유도한 SD rat에게 8주간 CGA113(50, 200 mg/kg)을 경구투여한 결과, 200 mg/kg CGA113을 처리한 군(CGA113-H)의 prostate ratio, serum DHT 및 prostate DHT, prostate 5α-reductase2가 BPH군과 비교하여 유의적으로 감소한 것을 확인할 수 있었다. 또한 CGA113을 투여한 동물의 전립선 조직을 H&E 염색하여 조직학적으로 관찰한 결과, BPH군과 비교하여 전립선 상피세포의 비후가 감소하고 내강이 확장된 것을 알 수 있었다. CGA113-H의 전립선 조직 내 Bax 단백질의 mRNA 수준 발현은 BPH군보다 유의적으로 증가하였고, Bax/Bcl2 ratio 또한 유의적으로 증가하였다. 이는 CGA 113에 포함된 녹용, 감초, 당귀의 다양한 활성 물질(liquiritin, decursin 등)의 개별 효과와 더불어 복합물의 시너지효과로 사료된다. 따라서 CGA113의 단일한 성분과 기전을 규명하고 추가적인 실험이 수행된다면 CGA113이 BPH 발달 억제 및 조절에 효과적인 대안이 될 수 있을 것으로 판단된다.

Fig 1.

Fig 1.Effects of Cervus elaphus antler 50% ethanol extract (CEE), Glycyrrhiza uralensis 50% ethanol extract (GUE), Angelica gigas 50% ethanol extract (AGE) or their combination in various ratios including CGA113 on cell viability of BPH-1 cells. All data are expressed as mean±SD; (n=10). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 886-893https://doi.org/10.3746/jkfn.2022.51.9.886

Fig 2.

Fig 2.Effects of CGA113 on mRNA expression levels of AR and SRD5A2 in BPH-1 cells. Quantitative real-time PCR was performed for examination of inhibitory effect of CGA113 on (A) AR and (B) SRD5A2 mRNA levels. All data are expressed as mean±SD; (n=10). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 886-893https://doi.org/10.3746/jkfn.2022.51.9.886

Fig 3.

Fig 3.Histopathological examination in prostate tissues of rats. H&E staining of prostate was performed from control and BPH rats administrated with or without CGA113. (A) control: Normal control with 100 μL corn oil injection, (B) BPH: castrated group with.TP (3mg/kg of BW/d) injection, (C) CGA113-L: castrated rats supplied with CGA113 50 mg/kg of BW/d and TP (3mg/kg of BW/d) injection, (D) CGA113-H: castrated rats supplied with CGA113 200 mg/kg of BW/d and TP (3mg/kg of BW/d) injection.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 886-893https://doi.org/10.3746/jkfn.2022.51.9.886

Fig 4.

Fig 4.Effect of CGA113 on DHT level in serum and prostate of rats. (A) Serum DHT level in rats, (B) DHT level in rat prostate tissues. All data are expressed as mean±SE (n=8). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 886-893https://doi.org/10.3746/jkfn.2022.51.9.886

Fig 5.

Fig 5.Effect of CGA113 on 5α-reductase1 and 5α-reductase2 level in rat prostate. ELISA assay of (A) SRD5A1 and (B) SRD5A2 level in prostate of rats. All data are expressed as mean±SE (n=8). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 886-893https://doi.org/10.3746/jkfn.2022.51.9.886

Fig 6.

Fig 6.Effect of CGA113 on mRNA expression levels of Bax, Bcl2 level, and Bax/Bcl-2 ratio in rat prostate. qPCR analysis of (A) Bax, (B) Bcl2, and (C) Bax/Bcl2 ratio in prostate tissues of rats supplemented by CGA113. All data are expressed as mean±SE (n=8). Different letters show significant differences among groups by Duncan’s multiple range test (P<0.05).
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 886-893https://doi.org/10.3746/jkfn.2022.51.9.886

Table 1 . Primers used for quantitative real time PCR.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
Human
GAPDHAGCCTTCTCCATGGTGGTGAAGACCGGAGTGAACGGATTTGGTCGTAT
SRD5A2CTACGGGAAGCACACGGAGAGCCTGAACCAGGCTTCCTGAGCTGGCGCAATATATAG
ARAGCACCATGCAACTCCTTCAGCACCGACACTGCCTTACACAA
Rat
GAPDHTGGAAGGACTCATGACCACATTCAGGTCAGGGATGACCTT
BaxCCAGGACGCATCCACCAAGAAGCTGCCACACGGAAGAAGACCTCTCG
Bcl2GAGGCTGGGATGCCTTTGTGGAGCTGAGCAGCGTCTTCAGAGA

Table 2 . Prostate weight of rats administered with CGA113.

GroupProstate weight (g)Prostate ratio1) (mg/100 g of BW)
Control0.64±0.03b0.12±0.01c
BPH0.98±0.07a0.24±0.02a
CGA113-L0.86±0.04a0.20±0.01ab
CGA113-H0.88±0.06a0.19±0.01b

1)Prostate ratio: prostate weight (mg)/ body weight (mg)×100 (g)..

Values are presented as means±SE. Different letters show a significantly difference at P<0.05 as determined by Duncan’s multiple range test. Control: Normal control with 100 μL corn oil injection, BPH: castrated group with TP (3 mg/kg of BW/d) injection, CGA113-L: castrated rats supplied with CGA113 50 mg/kg of BW/d and TP (3 mg/kg of BW/d) injection, CGA113- H: castrated rats supplied with CGA113 200 mg/kg of BW/day and TP (3 mg/kg of BW/d) injection..


Table 3 . The Effects of CGA113 on liver damage in rats.

GroupLiver weight ratio1) (%)ALT (U/I)AST (U/I)
Control3.23±0.08a53.50±6.78a97.50±7.78a
BPH3.26±0.08a53.50±4.68a112.40±9.25a
CGA113-L3.37±0.09a57.00±5.12a102.20±7.08a
CGA113-H3.12±0.11a44.70±6.51a112.60±12.64a

1)Liver weight ratio (%): liver weight (g)/ body weight (g)×100..

Values are presented as means±SE. Different letters show a significantly difference at P<0.05 as determined by Duncan’s multiple range test. control: Normal control with 100 μL corn oil injection, BPH: castrated group with TP (3 mg/kg of BW/d) injection, CGA113-L: castrated rats supplied with CGA113 50 mg/kg of BW/d and TP (3 mg/kg of BW/d) injection, CGA113-H: castrated rats supplied with CGA113 200 mg/kg of BW/d and TP (3 mg/kg of BW/d) injection..


References

  1. Bartsch G, Rittmaster RS, Klocker H. Dihydrotestosterone and the concept of 5α-reductase inhibition in human benign prostatic hyperplasia. Eur Urol. 2000. 37:367-380.
    Pubmed CrossRef
  2. Bode AM, Dong Z. Toxic phytochemicals and their potential risks for human cancer. Cancer Prev Res (Phila). 2015. 8:1-8.
    Pubmed KoreaMed CrossRef
  3. Carson Ⅲ C, Rittmaster R. The role of dihydrotestosterone in benign prostatic hyperplasia. Urology. 2003. 61(4 Suppl 1):2-7.
    CrossRef
  4. Chen JC, Hsiang CY, Lin YC, Ho TY. Deer antler extract improves fatigue effect through altering the expression of genes related to muscle strength in skeletal muscle of mice. Evid Based Complement Altern Med. 2014. Article ID 540580. https://doi.org/10.1155/2014/540580
    Pubmed KoreaMed CrossRef
  5. Cicero AFG, Allkanjari O, Busetto GM, Cai T, Larganà G, Magri V, et al. Nutraceutical treatment and prevention of benign prostatic hyperplasia and prostate cancer. Arch Ital Urol Androl. 2019. 91:139-152.
    Pubmed CrossRef
  6. Deslypere JP, Young M, Wilson JD, McPhaul MJ. Testosterone and 5α-dihydrotestosterone interact differently with the androgen receptor to enhance transcription of the MMTV-CAT reporter gene. Mol Cell Endocrinol. 1992. 88:15-22. https:// doi.org/10.1016/0303-7207(92)90004-P
    CrossRef
  7. Edlich F. BCL-2 proteins and apoptosis: Recent insights and unknowns. Biochem Biophys Res Commun. 2018. 500:26-34.
    Pubmed CrossRef
  8. Fertig RM, Gamret AC, Darwin E, Gaudi S. Sexual side effects of 5-α-reductase inhibitors finasteride and dutasteride: A comprehensive review. Dermatol Online J. 2017. 23:3. https://doi.org/10.5070/d32311037240
    Pubmed CrossRef
  9. Izumi K, Mizokami A, Lin WJ, Lai KP, Chang C. Androgen receptor roles in the development of benign prostate hyperplasia. Am J Pathol. 2013. 182:194P<1949.
    Pubmed KoreaMed CrossRef
  10. Jiang C, Lee HJ, Li GX, Guo J, Malewicz B, Zhao Y, et al. Potent antiandrogen and androgen receptor activities of an Angelica gigas-containing herbal formulation: Identification of decursin as a novel and active compound with implications for prevention and treatment of prostate cancer. Cancer Res. 2006. 66:453-463.
    Pubmed CrossRef
  11. Juckett DA. What determines age-related disease: do we know all the right questions?. Age. 2010. 32:155-160.
    Pubmed KoreaMed CrossRef
  12. Kim BS, Seo H, Kim HJ, Bae SM, Son HN, Lee YJ, et al. Decursin from Angelica gigas Nakai inhibits B16F10 melanoma growth through induction of apoptosis. J Med Food. 2015. 18:1121-1127.
    Pubmed KoreaMed CrossRef
  13. Kim S, Lee SI, Kim N, Joo M, Lee KH, Lee MW, et al. Decursin inhibits cell growth and autophagic flux in gastric cancer via suppression of cathepsin C. Am J Cancer Res. 2021. 11:1304- 1320.
  14. Liu J, Fang T, Li M, Song Y, Li J, Xue Z, et al. Pao pereira extract attenuates testosterone-induced benign prostatic hyperplasia in rats by inhibiting 5α-reductase. Sci Rep. 2019. 9:19703. https://doi.org/10.1038/s41598-019-56145-z
    Pubmed KoreaMed CrossRef
  15. Nikolaou N, Hodson L, Tomlinson JW. The role of 5-reduction in physiology and metabolic disease: evidence from cellular, pre-clinical and human studies. J Steroid Biochem Mol Biol. 2021. 207:105808. https://doi.org/10.1016/J.JSBMB.2021.105808
    Pubmed CrossRef
  16. Park E, Lee MY, Jeon WY, Lee N, Seo CS, Shin HK. Inhibitory effect of Yongdamsagan-tang water extract, a traditional herbal formula, on testosterone-induced benign prostatic hyperplasia in rats. Evid Based Complement Altern Med. 2016. Article ID 1428923. https://doi.org/10.1155/2016/1428923
    Pubmed KoreaMed CrossRef
  17. Park E, Lee MY, Jeon WY, Seo CS, You S, Shin HK. Paljung- San, a traditional herbal medicine, attenuates benign prostatic hyperplasia in vitro and in vivo. J Ethnopharmacol. 2018. 218:109-115.
    Pubmed CrossRef
  18. Park HS, Seo CS, Wijerathne CUB, Jeong HY, Moon OS, Seo YW, et al. Effect of Veratrum maackii on testosterone propionate-induced benign prostatic hyperplasia in rats. Biol Pharm Bull. 2019. 42:1-9.
    Pubmed CrossRef
  19. Quiles MT, Arbós MA, Fraga A, de Torres IM, Reventós J, Morote J. Antiproliferative and apoptotic effects of the herbal agent Pygeum africanum on cultured prostate stromal cells from patients with benign prostatic hyperplasia (BPH). Prostate. 2010. 70:1044-1053.
    Pubmed CrossRef
  20. Rim HK, Cho W, Sung SH, Lee KT. Nodakenin suppresses lipopolysaccharide-induced inflammatory responses in macrophage cells by inhibiting tumor necrosis factor receptor-associated factor 6 and nuclear factor-κB pathways and protects mice from lethal endotoxin shock. J Pharmacol Exp Ther. 2012. 342:654-664.
    Pubmed CrossRef
  21. Roehrborn CG. Benign prostatic hyperplasia: An overview. Rev Urol. 2005. 7(Suppl 9):S3-S14.
  22. Roehrborn CG. Pathology of benign prostatic hyperplasia. Int J Impot Res. 2008. 20(Suppl 3):S11-S18.
    Pubmed CrossRef
  23. Sarker SD, Nahar L. Natural medicine: The genus angelica. Curr Med Chem. 2004. 11:1479-1500.
    Pubmed CrossRef
  24. Sowndhararajan K, Kim S. Neuroprotective and cognitive enhancement potentials of Angelica gigas Nakai root: A review. Sci Pharm. 2017. 85:21. https://doi.org/10.3390/scipharm85020021
    Pubmed KoreaMed CrossRef
  25. Steers WD. 5α-reductase activity in the prostate. Urology. 2001. 58(6):17-24.
    CrossRef
  26. Sui Z, Zhang L, Huo Y, Zhang Y. Bioactive components of velvet antlers and their pharmacological properties. J Pharm Biomed Anal. 2014. 87:229-240.
    Pubmed CrossRef
  27. Tang Y, Fan M, Choi YJ, Yu Y, Yao G, Deng Y, et al. Sika deer (Cervus nippon) velvet antler extract attenuates prostate cancer in xenograft model. Biosci Biotechnol Biochem. 2019. 83:348-356.
    Pubmed CrossRef
  28. Vaya J, Belinky PA, Aviram M. Antioxidant constituents from licorice roots: Isolation, structure elucidation and antioxidative capacity toward LDL oxidation. Free Radical Biol Med. 1997. 23:30P<313.
    CrossRef
  29. Wang JR, Li TZ, Wang C, Li SM, Luo YH, Piao XJ, et al. Liquiritin inhibits proliferation and induces apoptosis in HepG2 hepatocellular carcinoma cells via the ROS-mediated MAPK/AKT/NF-κB signaling pathway. Naunyn Schmiedeberg’s Arch Pharmacol. 2020. 393:1987-1999.
    Pubmed CrossRef
  30. Wang ZY, Nixon DW. Licorice and cancer. Nutr Cancer. 2001. 39:1-11.
    Pubmed CrossRef
  31. Wu F, Li H, Jin L, Li X, Ma Y, You J, et al. Deer antler base as a traditional Chinese medicine: A review of its traditional uses, chemistry and pharmacology. J Ethnopharmacol. 2013. 145:403-415.
    Pubmed CrossRef
  32. Zhang J, Li L, Jiang C, Xing C, Kim SH, Lu J. Anti-cancer and other bioactivities of Korean Angelica gigas Nakai (AGN) and its major pyranocoumarin compounds. Anti-Cancer Agents Med Chem. 2012. 12:1239-1254.
    Pubmed CrossRef
  33. Zhang LZ, Xin JL, Zhang XP, Fu Q, Zhang Y, Zhou QL. The anti-osteoporotic effect of velvet antler polypeptides from Cervus elaphus Linnaeus in ovariectomized rats. J Ethnopharmacol. 2013. 150:181-186.
    Pubmed CrossRef
  34. Zhou R, Li S. In vitro antioxidant analysis and characterisation of antler velvet extract. Food Chem. 2009. 114:1321-1327.
    CrossRef
  35. Zhou Y, Ho WS. Combination of liquiritin, isoliquiritin and isoliquirigenin induce apoptotic cell death through upregulating p53 and p21 in the A549 non-small cell lung cancer cells. Oncol Rep. 2014. 31:298-304.
    Pubmed CrossRef