검색
검색 팝업 닫기

Ex) Article Title, Author, Keywords

JKFN Journal of the Korean Society of Food Science and Nutrition



Online ISSN 2288-5978

Article

home All Articles View

Article

Split Viewer

Journal of the Korean Society of Food Science and Nutrition 2022; 51(5): 412-418

Published online May 31, 2022 https://doi.org/10.3746/jkfn.2022.51.5.412

Copyright © The Korean Society of Food Science and Nutrition.

Enhancement of the Skin-Whitening and UV-Absorption Effects of Angelica gigas Extract by Lactiplantibacillus plantarum Fermentation

Jun Hee Kim , Youn Seon Hwang, Min Hoo Kang, Suh Hee Yeom, Jae Hoon Park, and Jin Woo Kim

Department of Food Science, SunMoon University

Correspondence to:Jin Woo Kim, Department of Food Science, SunMoon University, 221-70 sunmoon-ro, Tangjeong-myeon, Asan-si, Chungnam 31460, Korea, E-mail: biochem.jk@gmail.com
Author information: Jun Hee Kim (Student), Youn Seon Hwang (Student), Min Hoo Kang (Student), Suh Hee Yeom (Student), Jae Hoon Park (Student), Jin Woo Kim (Professor)

Received: February 10, 2022; Revised: April 13, 2022; Accepted: April 18, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

This study was conducted to enhance the production of bioactive materials with skin-whitening and ultraviolet (UV)-A absorption activities using bioconverted Angelica gigas extract (BAE). The UV-B absorption and tyrosinase activity inhibition of the BAE using Lactiplantibacillus plantarum were 51.7±0.6% and 49.7±0.3%, respectively, which were 2.1 and 1.9 times higher than that of the hot-water extract. The cytotoxicity of BAE to B16F0 cells was analyzed using MTT assay, and no inhibition of cell growth was confirmed below 1 mg/mL. To study the mechanism of melanin synthesis for confirming the skin-whitening effects of BAE, the mRNA levels of tyrosinase related protein-1 (TRP-1) and protein-2 (TRP-2) were compared using a reverse transcription-polymerase chain reaction. The BAE reduced the expressions of TRP-1 and TRP-2, by 1.4 and 2.1 times, respectively, compared to HAE, proving that BAE is effective in inhibiting melanin synthesis. The bioconversion of BAE using L. plantarum showed enhanced UV-absorption and skin-whitening effects. Thus, BAE can be used as a multi-functional cosmetic ingredient with both UV-absorption and skin-whitening functions.

Keywords: Angelica gigas, Lactiplantibacillus plantarum, UV-absorption, skin-whitening, bioconversion

멜라닌(melanin)은 표피의 기저층에 존재하는 멜라닌세포의 멜라닌소체에서 타이로시나제와 타이로시나제 관련 단백질(tyrosinase related protein, TRP)에 의해 생성되며 수지상 돌기를 통해 각질세포로 이동하여 피부색을 띠게 하고 자외선으로부터 피부세포를 보호하는 역할을 한다(Lee, 2021; Choi 등, 2014). 멜라닌 생성의 주요 효소로 알려진 타이로시나제는 폴리페놀 산화효소의 일종으로 타이로신을 도파(dopa)와 도파퀴논(dopaquinone)으로 변환시키고 도파퀴논의 자동산화에 의해 도파크롬(dopachrome)으로 변화시킨다(Seo 등, 2010). 도파크롬은 TRP-2에 의해 산화되어 5,6-dihydroxyindole-2-carboxylic acid로 변화되며, 최종적으로 TRP-1의 촉매에 의해 황적색을 나타내는 페오멜라닌과 흑색을 나타내는 유멜라닌이 합성되고 피부, 머리카락과 눈동자의 색깔 등을 결정하게 된다(Kim 등, 2018; Lee와 Song, 2004). 표피 최외각의 각질세포에 존재하는 멜라닌이 자외선에 노출되면 여기 상태(excited state)가 되고 다시 기저 상태(ground state)로 복원되면서 흡수했던 에너지를 열에너지로 방출하여 자외선으로부터 피부를 보호하고 체온을 유지하는 등 중요한 기능을 수행하게 된다(Im, 2008; Lee, 1996). 반면 과도한 자외선 노출, 피부 내 활성산소 증가, 스트레스와 염증 반응 등에 의해 멜라닌이 과량 합성되면 색소침착에 따른 기미나 주근깨 등을 유발하므로 보다 효과적인 미백 효과를 위해서는 피부에 흡수되는 자외선 차단과 동시에 TRP 계열 단백질의 활성 저해가 병행되어야 한다(Park 등, 2019; Kwon 등, 2014).

멜라닌 생성을 촉진하는 자외선은 태양광선의 전자파장에 따라 UV-A(장파장, 320~400 nm), UV-B(중파장, 28 ~320 nm)와 UV-C(단파장, 200~280 nm)로 분류된다(Kim과 Lee, 2016). UV 스펙트럼 중 생물에게 가장 위험한 UV-C 스펙트럼의 대부분은 대기상층의 산소 분자에 의해 성층권의 오존에 흡수되어 지상에 도달하지 않으나, 오존에 의해 50% 흡수되는 UV-A는 피부를 침투해 피폭에 의한 즉시형 색소침착을 발생시켜 피부 흑화나 광노화를 유발하며, 오존에 90% 이상 흡수되는 UV-B는 고에너지 준위에 의한 일광화상을 통해 홍반을 유발하여 자연형 색소침착을 일으키게 된다(Lee 등, 2003; Chang, 2016; Jeong 등, 2011). 또한, 지속해서 자외선에 노출된 피부세포는 다량의 활성산소를 발생시키고 세포 내 단백질, 지질 및 DNA의 손상을 일으켜 피부암의 원인이 된다(Lee 등, 2001). 따라서 자외선으로부터 피부를 보호하기 위한 자외선 흡수제 필요성이 증가하고 있으며 세계 시장 규모는 2021년 7,620억 원으로 유기와 무기 자외선 흡수제가 각각 78%와 22%로 시장을 형성하고 있다(Kim과 Nam, 2021). 2021년부터 미국을 중심으로 유기 자외선 흡수제에 사용되는 옥티녹세이트와 옥시벤존의 사용을 금지하는 법안이 발효되어 무기 자외선 흡수제의 사용이 증가할 것으로 예상되나 무기 자외선 흡수제의 주요 원료인 이산화티탄, 파라아미노안식향산과 벤조페논의 피부 자극성, 피부 과민 반응과 백탁 현상 등의 부작용으로 인해 상기 물질을 포함하지 않은 천연물 소재 자외선 흡수제의 수요가 급증할 것으로 전망되고 있다(Park 등, 2005; Kim 등, 2002).

당귀(Angelica gigas)는 미나리과에 속하는 다년생 초본으로 전 세계적으로 광범위하게 재배되고 있으며 한방에서 혈액 순환을 도와 빈혈이나 부인병 등에 대한 보혈제로 민간에서 널리 사용되는 약재이다(Oh 등, 1999; Kim 등, 2013). 기존 연구에 따르면 당귀 추출물의 생리활성물질은 데커시놀, 움벨리페론, 쿠마린과 베타시토스테롤 등으로 항염증, 항암과 항산화 효과가 높다고 알려져 있다(Choi 등, 2012; Sung과 Kim, 2005). 또한, 당귀 추출물의 주요성분인 데커신과 데커신의 이성질체인 데커시놀은 혈행 및 인지 개선 효과가 있어 노화로 저하된 인지기능과 만성 퇴행성 질환 개선에 도움을 주는 물질로 식품의약품안전처(식약처)의 개별인정형 원료로 인증받아 관절 기능성식품과 치매 치료제로 개발이 진행되고 있다(Kim 등, 2019; Lee 등, 2008). 최근 미백 화장품 소재로 개발되고 있는 일부 약용식물 유래 추출물은 멜라닌세포에 대해 독성을 나타낸다는 보고가 있어 균주를 이용한 발효를 통해 추출물의 세포독성을 경감시키려는 연구가 지속되고 있으며, 이에 발효과정에서 생산되는 효소에 의한 천연물의 생물전환을 통해 저분자화에 따른 배당체, 핵산 및 펩타이드 등의 생리활성물질을 생산하는 기술이 개발되는 추세이나 현재까지 당귀 열수 추출물 생물전환을 통한 미백 및 UV 흡수 효과 증진에 관한 연구는 미흡한 실정이다(Che 등, 2010; Sim 등, 2021). 본 연구에서는 김치에서 분리한 Lactiplantibacillus plantarum SM4를 이용해 당귀 열수 추출물을 생물전환하여 타이로시나제 저해 효과와 자외선 흡수 효과를 비교하고 TRP-1과 TRP-2의 유전자 발현에 미치는 영향평가를 통해 멜라닌 생성 저해 기전을 규명하고자 하였다. 이를 위해 최근 국내 식・의약품 산업에서 널리 이용되고 있는 생물전환 기술을 이용하여 당귀 추출물의 자외선 흡수 및 피부 미백 활성 증진 효과를 평가하여 당귀의 향장 소재화를 위한 기초자료를 제공하고자 하였다.

실험 재료

본 연구에서는 2020년도에 강원도 평창에서 생산된 당귀를 라이프스토리(Yongin, Korea)에서 건조물로 구매하여 사용하였으며, 분석에 이용된 시약인 tyrosinase from mushroom, 3,4-dihydroxyphenylalanine(L-DOPA)과 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoliumbromide(MTT) 등은 Sigma-Aldrich(St. Louis, MO, USA)에서 구매하였다. 세포 배양을 위한 시약인 Dulbecco’s modified Eagle medium(DMEM), fetal bovine serum(FBS)과 trypsin은 Gibco(Waltham, MA, USA)의 제품을 사용하였으며, 균주 배양을 위한 Difco MRS 배지는 BD Biosciences(Sparks, NV, USA)에서 구매하여 이용하였다. 그 외 실험에 사용된 모든 분석 시약들은 Sigma-Aldrich의 일급(EP) 이상 시약을 사용하였다.

당귀 열수 추출

당귀 열수 추출물 제조를 위해 건조된 시료 1.0 g에 1차 증류수 10.0 mL를 첨가하여 초음파 추출기(SD-D250H, Sungdong Co., Hwaseong, Korea)를 이용해 40 kHz와 200 W로 60.0°C에서 30분간 추출을 진행하였다. 추출 후 원심분리기(Lobogene 1236R, Gyrozen, Daejeon, Korea)를 이용하여 4.0°C, 5,000 rpm과 10분간 고액 분리하고 상등액을 취하여 -21.0°C에 보관하면서 필요에 따라 희석하여 실험에 이용하였다.

균주 분리

당귀 열수 추출물 생물전환을 위한 균주는 김치로부터 분리하였고 배양을 위해 Difco MRS 배지를 사용하여 고체와 액체배지를 각각 제조하였다. 균주 분리를 위해 1:100으로 희석한 김칫국물 0.1 mL를 MRS 평판배지에 도말하여 37.0°C 항온기에서 24시간 배양하였으며, 백금이를 이용해 단일 집락을 선별하여 균을 MRS 배지에 접종하여 항온기에서 48시간 배양하였다. 이후 베타-글루코시데이즈 활성이 높은 균주를 선발하기 위해 API ZYM kit(BioMerieux, Marcy-l’Étoile, France)을 이용하여 베타-글루코시데이즈 효소 활성을 검사하였다.

당귀 열수 추출물 생물전환

생물전환을 위해 본 연구실에서 김치로부터 분리한 L. plantarum SM4를 사용하였다. 배양을 위해 MRS 액체배지를 제조하고 1 M HCl과 1 M NaOH로 pH를 7.0으로 조정하고 엘렌마이어 플라스크(Erlenmeyer flask)에 분주하여 고압멸균기(SAC05060P, Daehan Sci., Wonju, Korea)에서 121.0°C로 15분간 멸균하여 배양 배지를 제조하였다. 멸균된 배지에 12시간 배양한 종균 1.0%를 접종하여 진탕배양기에서 37.0°C, 150 rpm으로 24시간 배양 진행 후 생물전환을 위해 당귀 열수 추출물과 배양액을 1:2 비율로 혼합하고 초기 pH를 5.0으로 조정하여 진탕배양기에서 37.0°C와 150 rpm으로 48시간 효소 분해를 진행하였다. 조효소액 생산을 위해 호모게나이저(HG-15A, Daehan Sci.)를 이용해 세포를 파쇄하였으며, 1 M HCl과 1 M NaOH를 이용하여 최종 pH를 5.0으로 조정하고 진탕배양기에서 45.0°C, 150 rpm과 48시간 추가적인 효소 분해를 진행 후 4.0°C에서 5,000 rpm으로 10분간 원심분리하여 생물전환물을 획득한 후 분석실험에 이용하였다.

타이로시나제 활성 저해율 측정

당귀 열수 추출물과 생물전환물의 타이로시나제 활성 저해율은 Kim 등(2012)의 분석법을 변형하여 측정하였다. 완충용액은 monobasic anhydrous와 dibasic anhydrous를 혼합하여 pH 6.8로 제조하였으며 완충용액을 이용하여 10 mM 기질액(L-DOPA)을 제조하였다. 시료 0.2 mL에 완충용액 0.4 mL, 기질액 0.2 mL와 타이로시나제(125 unit/mL) 0.2 mL를 첨가하여 실온에서 20분간 반응을 진행하였으며 대조군에는 시료 대신 증류수를 첨가하였다. 반응 후 분광광도계(Mecasys Co., Daejeon, Korea)를 이용해 475 nm에서 흡광도를 측정하고 타이로시나제 활성 저해율은 아래 식에 따라 L-ascorbic acid를 양성대조군으로 하여 백분율로 산출하였다.

(%)=1AB×100A: , B:

자외선 흡수율 측정

당귀 열수 추출물과 생물전환물의 자외선 흡수율을 비교하기 위해 열수 추출물과 생물전환물의 상등액을 증류수로 각각 50배 희석한 후 분광광도계를 이용하여 UV-A, UV-B와 UV-C 스펙트럼 구간인 200~400 nm에서 흡수율을 측정하였다. 대조군으로는 향장용 자외선 흡수제인 disodium phenyl dibenzimidazole(DPD, 0.1 mg/mL)을 사용하여 흡수율 비교를 통해 아래 식을 이용해 백분율로 산출하였다.

(%)=1AB×100A: , B:

세포 배양

당귀 생물전환물이 세포 성장에 미치는 영향과 TRP 유전자 기반 미백 활성 기전 규명을 위한 실험 수행을 위해 마우스 유래 B16F0(흑색종세포)를 생물자원센터(Jeongeup, Korea)에서 분양받아 사용하였다. 세포 배양을 위해 10.0% FBS와 1.0% penicillin이 포함된 DMEM 배지를 사용하였으며 B16F0를 배양 플라스크에 5.0×104 cells/mL로 분주하여 동물세포 배양기(SA-MCO-18AIC, Sanyo Co., Osaka, Japan)에서 37.0°C와 5.0% CO2를 유지하며 배양하였다.

세포독성 평가

당귀 생물전환물의 세포독성 평가를 위해 MTT 분석법에 기반하여 B16F0를 1.0×104 cells/mL로 96-well plate에 0.18 mL씩 분주하여 24시간 배양하였다. 당귀 생물전환물을 DMEM 배지에 희석하여 B16F0에 농도별로 0.02 mL씩 분주하였으며, 대조군에는 생물전환물 대신 DMEM 배지를 첨가하여 72시간 배양하였다. 배지를 제거한 후 0.25 mg/mL MTT 시약을 0.1 mL 처리하여 동물세포 배양기에서 4시간 반응 후 시약을 제거하고 dimethyl sulfoxide 0.1 mL를 첨가한 후 마이크로 플레이트 리더(Infinite® 200, Tecan Group Ltd., Männedorf, Switzerland)를 이용하여 450 nm에서 흡광도를 측정하였다. 세포 생존율은 아래의 식을 이용하여 백분율로 산출하였다.

%=1AB×100A: , B:

당귀 생물전환물의 미백 효과 확인을 위해 관련 주요 유전자 발현을 평가하였다. 세포 배양을 위해 24-well plate에 1.0×105 cells/mL로 세포를 분주하고 당귀 생물전환물을 농도별로 처리하여 세포 배양기에서 24시간 배양하고 세포 회수를 위해 trypsin-EDTA를 처리한 후 2,000 rpm에서 2분간 원심분리하였다. 회수된 세포는 Accuprep® universal RNA extraction kit(Bioneer, Daejeon, Korea)을 이용해 total RNA를 추출하였고 ER 완충용액을 대조군으로 흡광도를 측정해 total RNA를 정량하였다. 추출한 RNA 1.0 µg에 2×cDNA synthesis 완충용액과 cDNA synthesis enzyme mix를 혼합한 후 diethylpyrocarbonate를 이용해 전체 부피가 20.0 µL가 되도록 PCR 튜브에 첨가한 후 각각 TRP-1과 TRP-2를 역전사 방법으로 증폭하였으며, 발현 평가를 위한 대조군으로 하우스키핑 유전자인 β-actin을 이용하였다. 실험에 사용된 프라이머 염기서열을 Table 1에 요약하였으며 모든 mRNA의 증폭 과정은 95.0°C에서 10분간 초기 변성을 진행하고 95.0°C에서 30초의 변성반응과 72.0°C에서 30초간 연장반응을 실시하였다. 결합반응 온도는 TRP-1과 TRP-2에서 각각 60.0°C와 54.0°C였으며 PCR 산물들은 gel red® nucleic acid gel stain(Komabiotech, Seoul, Korea) 10.0 µL를 첨가하고 1.5% 아가로스 겔에 전기영동 한 후 Geldoc(BioRad, Hercules, CA, USA)을 이용하여 유전자 발현을 확인하였다.

Table 1 . Primer design to evaluate the expression levels of major genes related to melanin production

PrimerForward (5'-3')Reverse (5'-3')Size (bp)
TRP-1GCTGCAGGAGCCTTCTTTCTCAAGACGCTGCACTGCTGGTCT398
TRP-2AGAAGTTTGACAGCCCTCCCTAACCGCAGAGCAACTTG360
β-ActinACTACCTCATGAAGATCCTGTTGCTGATCCACATCTGCTG731


통계분석

통계분석을 위해 모든 실험은 3 반복 수행하였으며 실험값은 평균표준편차로 나타내었다. 통계적 검증은 Graphpad Prism software(San Deigo, CA, USA)를 이용하였으며, 각 실험군의 유의성 평가는 independent t-test를 이용해 분석하였고 전체 실험군의 유의성 평가는 일변수 분산분석을 이용해 분석하여 P<0.05를 기준으로 실험군 간의 유의성을 평가하였다.

자외선 흡수율 측정

지표면에 도달하는 자외선은 UV-A, UV-B와 UV-C로 분류되며 피부 진피층 투과를 통해 DNA 손상 및 활성산소종을 생성하는 원인으로, 멜라닌세포 내 타이로시나제의 활성화를 통해 멜라닌 생성을 유도하여 피부 흑화, 색소침착, 광노화는 물론 피부암을 유발해 자외선 흡수제 개발에 있어 UV의 흡수율이 중요한 평가지표이다(Kim 등, 1994; Hwang 등, 2013; Shin 등, 1996). 당귀 열수 추출물과 생물전환물의 자외선 효과 평가를 위해 UV 전 영역에서 흡수율을 비교했을 때 두 실험군 모두 UV-B 구간에서 가장 높은 흡수율을 보였으며, 300 nm UV-B에 대해 DPD 대비 26.20.9%와 49.70.3%의 흡수 효과가 확인되어 당귀 추출물과 생물전환물을 이용한 UV 흡수제 개발에 있어 DPD 대체를 통해 부작용이 저감된 천연 소재로 활용이 가능할 것으로 사료된다. 자외선 중 UV-B는 피부의 색소침착을 유발하여 표면의 유연성이 저하되고 만성적으로 노출되면 피부세포 내의 산화반응이 촉진되어 노화와 육종 현상이 유발되기 때문에, UV-B 흡수를 통한 피부보호를 위한 인체 안전성이 높은 천연 유래 성분으로부터 유용한 항산화 물질을 찾는 연구가 지속되는 추세이다. 이에 비해 UV-C 영역인 270 nm에서 24.20.7%와 40.41.9%의 흡수율이 확인되어 추출물과 생물전환물이 UV-B와 UV-C의 효과적인 흡수제로 작용함을 알 수 있었다. 특히, 두 영역에서 흡수 효과를 비교했을 때 열수 추출물 대비 생물전환물에서 1.9배와 1.7배가 증가하여 당귀 추출물의 발효에 의해 UV 흡수율이 높아짐이 확인되었다(Fig. 1). 이러한 증진 효과는 추출물 내의 결합형으로 존재하는 폴리페놀과 같은 생리활성물질이 생물전환에 의해 가수분해되어 저분자의 유리형 펩타이드, 비당체 또는 핵산 등으로 전환됨에 따라 UV-B와 UV-C의 흡수 효과가 증진된 것으로 예측된다(Kim 등, 2021; Hong 등, 2021). 본 연구에서 당귀 열수 추출물의 생물전환을 통해 UV-B와 UV-C 흡수율 증가가 확인됨에 따라 미백 활성 증진에 효과가 있을 것으로 사료되며, 이를 검증하기 위해 타이로시나제 활성 저해 평가, 세포독성 평가와 미백 활성 기전 규명에 관한 추가적인 연구가 필요할 것으로 판단된다.

Fig. 1. Comparison of changes in UV-absorbance profiles of BAE and HWE. Results are expressed as mean±standard deviation (n=3) (A). Comparison of absorbance of HWE and BAE compared to DPD in UV-A range (B). Comparison of absorbance of HWE and BAE compared to DPD in UV-B range (C). Comparison of absorbance of HWE and BAE compared to DPD in UV-C range (D). HWE: hot water extract, BAE: bioconverted A. gigas extract.

타이로시나제 활성 저해율 측정

타이로신은 타이로시나제에 의해 멜라닌 생성의 전구체가 되는 도파와 도파퀴논으로 대사되므로 타이로시나제의 저해를 통해 피부의 멜라닌 생성 감소에 따른 미백 효과를 기대할 수 있다(Choi 등, 2006). 당귀 열수 추출물과 생물전환물의 미백 활성을 평가하기 위해 멜라닌 생성의 주요 효소인 타이로시나제 활성 저해율을 비교한 결과 각각 24.8±0.2%와 51.7±0.6%로 나타나 생물전환물에서 2.1배 증가한 것을 확인하였으며, L. plantarum SM4를 이용한 생물전환을 통해 타이로시나제 활성 저해를 증가시킴에 따른 미백 효과 증진이 가능함을 확인하였다(Fig. 2). 이는 Lee 등(2018)의 연구에서 보리 씨앗 열수 추출물과 L. brevis를 이용한 생물전환물의 타이로시나제 활성 저해율이 각각 39.1±0.03%와 47.9±0.02%로 나타나 본 연구의 타이로시나제 활성 저해가 각각 1.6배와 1.1배 우수함이 입증되었다. 기존 대마 씨 미백 활성 연구에서 L. plantarum을 이용한 생물전환에 있어 폴리페놀과 플라보노이드 함량이 열수 추출물 대비 1.1배와 1.6배 증가하였으며, 폴리페놀 함량과 타이로시나제 활성이 반비례한다는 Yoon 등(2018)의 결과에 기반할 때 생물전환물의 폴리페놀 화합물이 티로시나제와 기질인 타이로신의 효소 결합에 있어 경쟁적 저해제(competitive inhibitor)로 작용하여 멜라닌 생합성 단계에서 티로시나제의 활성을 저해하고 타이로신의 산화를 억제함으로써 미백 효과가 증가한 것으로 예측된다(Yoon 등, 2018; Kim, 2009).

Fig. 2. Comparison of tyrosinase activity inhibition of HWE and BAE. Results are expressed as mean±standard deviation (n=3). HWE: hot water extract, BAE: bioconverted A. gigas extract.

세포독성 평가

당귀 생물전환물이 멜라닌 생성의 주요 유전자인 TRP-1과 TRP-2 발현에 미치는 영향을 평가하기에 앞서 세포성장 최소 억제농도를 확인하기 위해 B16F0에 당귀 생물전환물을 농도별(0.0~4.0 mg/mL)로 처리하여 세포 생존율을 조사했을 때, 당귀 생물전환물의 농도가 세포 생존율에 유의한 영향을 미치며 농도 의존적으로 생존율이 감소하는 것을 확인하였다(P<0.05). 생물전환물을 1.0과 2.0 mg/mL 처리했을 때 세포 생존율이 대조군 대비 97.8±0.3%(P=0.0546)와 89.6±0.5%(P=0.0032)로 나타나 1.0 mg/mL 이하의 농도에서 세포성장을 저해하지 않는 것으로 확인되었다(Fig. 3). 당귀 생물전환물 처리에 따른 TRP-1과 TRP-2의 발현 저해와 멜라닌 생성 저해 기전 규명을 평가하기 위해 세포성장 최소 억제농도인 1.0 mg/mL로 생물전환물 처리농도를 결정하여 멜라닌 생성의 핵심 유전자 발현 확인을 위한 RT-PCR 실험을 진행하였다.

Fig. 3. Inhibitory effects of HWE and BAE concentrations on cell growth of B16F0. Cells were incubated after adding different concentrations of HWE and BAE. The cell growth of the nontreated group (N.T.) was represented as 100% of cell viability. Results are expressed as mean±standard deviation (n=3). *P<0.05.

유전자 발현 평가

멜라닌은 타이로시나제, TRP-1과 TRP-2에 의해 아미노산의 일종인 타이로신을 도파와 도파퀴논으로 전환한 후 자동산화 과정과 단백질 중합반응에 의해 합성되므로 천연물 유래 미백 물질 탐색에 있어 타이로시나제, TRP-1과 TRP-2의 저해를 통한 멜라닌 생성 감소 효과를 중심으로 연구가 활발히 진행되고 있다(Yu 등, 2015). 생물전환물이 B16F0 성장 저해에 따른 유전자 발현에 미치는 영향을 최소화하고자 앞선 세포독성 평가에 기반하여 B16F0에 무독한 농도인 0.0~1.0 mg/mL에서 TRP-1과 TRP-2의 발현도를 평가하였다. 당귀 생물전환물 처리 시 농도 증가에 따라 TRP-1과 TRP-2의 발현이 감소하였으며, 1.0 mg/mL 첨가 시 각각 1.4배와 2.1배로 유의하게 감소한 것으로 확인되었다(P<0.05, Fig. 4). 이러한 결과는 Lee 등(2013)의 미백 소재 추출 연구에서 타이로시나제 활성 저해가 높았던 노간주나무 추출물이 B16F10에서 TRP-1과 TRP-2의 발현을 감소시킨다는 결과와 유사함이 확인되었다. 미백 소재 개발에 있어 TRP-1과 TRP-2 발현 저해는 중요한 요소로 당귀 생물전환물이 멜라닌 생성의 주요 효소인 TRP-1과 TRP-2의 활성 저해를 통한 멜라닌 생성 감소로 미백 효과가 증진됨이 확인되었다.

Fig. 4. The expressions of β-actin, TRP-1, and TRP-2 in B16F0 cells treated with BAE were evaluated. β-Actin was used as internal control.

당귀 열수 추출물로부터 미백 및 자외선 흡수 효과를 가지는 생리활성물질 추출 및 효과 증진을 위해 김치에서 분리한 L. plantarum SM4를 이용하여 생물전환을 수행하고 미백 기능성을 평가하였다. 당귀 생물전환물의 UV-B 흡수 효과와 타이로시나제 활성 저해율을 평가했을 때 각각 49.70.3%와 51.71.9%로 당귀 열수 추출물 대비 1.9배와 2.1배 증가함이 확인되어 L. plantarum SM4를 이용한 생물전환을 통해 저분자화된 유리형 생리활성물질에 의해 자외선 흡수와 미백에 효과가 증대되었음을 확인할 수 있었다. 세포독성 검사에서 당귀 생물전환물 1.0 mg/mL 이하 농도에서 B16F0에 대한 무독성이 확인되어 당귀 생물전환물이 피부에 안전한 자외선 흡수와 미백 소재로써 활용이 가능할 것으로 결론지을 수 있다. 관련 기전 규명을 위해 멜라닌 생성 저해의 핵심 유전자인 TRP-1과 TRP-2의 발현도를 평가했을 때 당귀 생물전환물 농도 증가에 따라 유전자 발현이 유의적으로 감소한 것을 확인하였다. 따라서 본 연구는 당귀 추출물의 L. plantarum SM4를 이용한 생물전환물이 피부에 흡수되는 자외선 흡수 감소와 함께 자외선에 의한 멜라닌 생성을 저해가 가능한 효과적인 미백 기능성 화장품 소재로 활용 가능할 것으로 기대된다.

  1. Chang MH. Research on the change of hair by an ultraviolet A. Journal of the Korean Society of Design Culture. 2016. 22:561-568.
  2. Che JY, Yang HJ, Jeong JJ, Seo WS, Park JS, Ok M, et al. Tyrosinase inhibition activity and antioxidant capacity by fermented products of some medicinal plants. J Life Sci. 2010. 20:940-947.
    CrossRef
  3. Choi CH, Wang KT, Cho HR, Jeong JG, Jeong HW. Inhibitory effects of Saposhnikoviae Radix extracts on the melanin production and elastase activity in B16F10 cells. J Orient Physiol Pathol. 2014. 28:296-302.
    CrossRef
  4. Choi SW, Kim EO, Leem HH, Kim JK. Anti-inflammatory effects of volatile flavor extracts from Cnidium officinale and Angelica gigas. J Korean Soc Food Sci Nutr. 2012. 41:1057-1065.
    CrossRef
  5. Choi SY, Kang NJ, Kim HC. Inhibitory effects of root extracts on melanin biosynthesis in Rodgersia podophylla A. Gray. Korean J Medicinal Crop Sci. 2006. 14:27-30.
  6. Hong JW, Park HY, Kim JH, Yeom SH, Kim JW. Antioxidation and anti-photoaging effects of white Taraxacum coreanum extract by Lactobacillus plantarum. Journal of the Korea Academia-Industrial cooperation Society. 2021. 22:554-562.
  7. Hwang SY, Lee JT, Kim YU, Kim HJ. Skin whitening effects of extracts from Angelicae gigantis Radix and Lycii fructus ethanol extracts. Herb Formula Sci. 2013. 21:91-98.
    CrossRef
  8. Im NK. Decomposition of melanin chromophore by phenolic solution. Master’s thesis. Chosun University, Gwangju, Korea. 2008.
  9. Jeong HR, Jo YN, Jeong JH, Jin DE, Song BG, Heo HJ. Whitening and anti-wrinkle effects of apple extracts. Korean J Food Preserv. 2011. 18:597-603.
    CrossRef
  10. Kim DM, Kim KH, Kim YS, Koh JH, Lee KH, Yook HS. A study on the development of cosmetic materials using unripe peaches seed extracts. J Korean Soc Food Sci Nutr. 2012. 41:110-115.
    CrossRef
  11. Kim GY, Lee SJ, Jeon MJ, Kim BM, Kim GT, Kang SM, et al. The evaluation of niacinamide-dipeptide convergence as skin whitening materials. KSBB J. 2018. 33:19-25.
    CrossRef
  12. Kim HY, Lee KY, Kim TH, Park AR, Noh HS, Kim SC, et al. Development and validation of analytical method for decursin in aerial parts of Angelica gigas Nakai extract. J Food Hyg Saf. 2019. 34:52-57.
    CrossRef
  13. Kim J, Lee DY, Sung SH, Kim J. Geographical classification of Angelica gigas using UHPLC-DAD combined multivariate analyses. Kor J Pharmacogn. 2013. 44:332-335.
  14. Kim JW, Suh SK, Choi JY, Park CW, Seo KW, Kim KB, et al. Studies on the correlation between SPF index and skin irritation index of sunscreens. J Appl Pharmacol. 2002. 10:246-252.
  15. Kim SS, Kim SD, Cho KM. A study on UV-CUT processing. J Kor Soc Dyers Finishers. 1994. 6(3):52-59.
  16. Kim SY, Gam DH, Kim JH, Yeom SH, Park JH, Kim JW. Enhancement of antioxidant and skin cancer inhibition effects by fermented Luffa aegyptiaca extract. Journal of the Korea Academia-Industrial cooperation Society. 2021. 22:408-414.
  17. Kim YH, Lee JS. Growth and contents of anthocyanins and ascorbic acid in lettuce as affected by supplemental UV-A LED irradiation with different light quality and photoperiod. Korean J Hortic Sci Technol. 2016. 34:596-606.
    CrossRef
  18. Kim YJ, Nam GW. Comparative analysis of UV protection factor measurement methods for each country and factors affecting UV protection factor. J Soc Cosmet Sci Korea. 2021. 47:193-203.
  19. Kim YJ. Evaluation of antioxidant activity and thermal stability of plant polyphenols. Biomater Res. 2009. 13:30-36.
  20. Kwon EJ, Park HJ, Kim MM, Lee KR, Hong I, Lee DG, et al. Effect of Ulmus macrocapa ethanolic extracts on anti-oxidant activity and melanin synthesis in B16F1 cells. J Life Sci. 2014. 24:946-951.
    CrossRef
  21. Lee EH, Lee JK, Hong JT, Jung KM, Kim YK, Lee SH, et al. Protective effect of green tea extract, catechin on UVB-induced skin damage. J Food Hyg Saf. 2001. 16:117-124.
  22. Lee EW, Song HR. A study on hair coloring useing natural vegetable dye. J Fash Bus. 2004. 8:125-135.
  23. Lee JH, Yoon YC, Kim JK, Park YE, Hwang HS, Kwon GS, et al. Antioxidant and whitening effects of the fermentation of barley seeds (Hordeum vulgare L.) using lactic acid bacteria. J Life Sci. 2018. 28:444-453.
  24. Lee KT, Lee BY, Won YI, Jee JB, Lee WH, Kim YJ. Radiative properties at King Sejong Station in West Antarctica with the radiative transfer model: A surface UV-A and erythemal UV-B radiation changes. Ocean Polar Res. 2003. 25:9-20.
    CrossRef
  25. Lee KY, Sung SH, Kim YC. Cognitive-enhancing activity of decursin derivatives. Kor J Pharmacogn. 2008. 39:86-90.
  26. Lee MS. B16F10 mouse cell to identify the enhancement of melanin synthesis of lincomycin. Master’s thesis. Jeju National University, Jeju, Korea. 2021.
  27. Lee S. Melanogenesis and its control. Proceedings of the Society of Cosmetic Scientists of Korea Symposium. 1996 Jul 1. Korea. p 22-32.
  28. Lee SY, Jun HJ, Lee JY. Down-regulation of tyrosinase, MITF, TRP-1, and TRP-2 expressions by Juniperus rigida Sieb. in murine B16F10 melanoma. J Life Sci. 2013. 23:1445-1453.
    CrossRef
  29. Oh SH, Cha YS, Choi DS. Effects of Angelica gigas Nakai diet on lipid metabolism, alcohol metabolism and liver function of rats administered with chronic ethanol. J Korean Soc Agric Chem Biotechnol. 1999. 42:29-33.
  30. Park JY, Lee HN, Hu MY, Park JH. Kojic acid derivatives, have tyrosinase inhibitory activity to suppress the production of melanin in the biosynthetic pathway. J Life Sci. 2019. 29:755-761.
  31. Park SH, Ahn JH, Moon KK, Bae DH, Kim MS, Lee S, et al. Study on the in vitro sun protection factor effect of nanosuspensions prepared using bead mill and high pressure homogenizer. J Kor Pharm Sci. 2005. 35:411-416.
    CrossRef
  32. Seo EJ, Hong ES, Choi MH, Kim KS, Lee SJ. Antioxidant and skin whitening effects of Rhamnus yoshinoi extracts. Korean J Food Sci Technol. 2010. 42:750-754.
  33. Shin DC, Lee JT, Chung Y, Kang NK, Yang JY. Application of the health risk models estimating skin cancer caused by UVB radiation. Kor J Environ Toxicol. 1996. 11:1-10.
  34. Sim JH, Lee KM, Park T, Kang MS, Hong H, Kim SY. Biorenovation-assisted modification of Ligustrum japonicum extract for skin-whitening effect. KSBB J. 2021. 36:30-35.
    CrossRef
  35. Sung KC, Kim KJ. Tyrosinase activated inhibition effect & analysis of pine-needles extract. J Korean Oil Chemists’ Soc. 2005. 22:71-76.
  36. Yoon YC, Kim BK, Kim JK, Lee JH, Park YE, Kwon GS, et al. Verification of biological activities and tyrosinase inhibition of ethanol extracts from hemp seed (Cannabis sativa L.) fermented with lactic acid bacteria. J Life Sci. 2018. 28:688-696.
  37. Yu JM, Kim DH, Son JH. whitening effects of solvent fractions isolated from Vitex rotundifolia. J Appl Biol Chem. 2015. 53:266-271.
    CrossRef

Article

Article

Journal of the Korean Society of Food Science and Nutrition 2022; 51(5): 412-418

Published online May 31, 2022 https://doi.org/10.3746/jkfn.2022.51.5.412

Copyright © The Korean Society of Food Science and Nutrition.

당귀 추출물의 Lactiplantibacillus plantarum 발효에 의한 미백 및 자외선 흡수 효과 증대

김준희․황윤선․강민호․염서희․박제훈․김진우

선문대학교 식품과학과

Received: February 10, 2022; Revised: April 13, 2022; Accepted: April 18, 2022

Enhancement of the Skin-Whitening and UV-Absorption Effects of Angelica gigas Extract by Lactiplantibacillus plantarum Fermentation

Jun Hee Kim , Youn Seon Hwang, Min Hoo Kang, Suh Hee Yeom, Jae Hoon Park, and Jin Woo Kim

Department of Food Science, SunMoon University

Correspondence to:Jin Woo Kim, Department of Food Science, SunMoon University, 221-70 sunmoon-ro, Tangjeong-myeon, Asan-si, Chungnam 31460, Korea, E-mail: biochem.jk@gmail.com
Author information: Jun Hee Kim (Student), Youn Seon Hwang (Student), Min Hoo Kang (Student), Suh Hee Yeom (Student), Jae Hoon Park (Student), Jin Woo Kim (Professor)

Received: February 10, 2022; Revised: April 13, 2022; Accepted: April 18, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

This study was conducted to enhance the production of bioactive materials with skin-whitening and ultraviolet (UV)-A absorption activities using bioconverted Angelica gigas extract (BAE). The UV-B absorption and tyrosinase activity inhibition of the BAE using Lactiplantibacillus plantarum were 51.7±0.6% and 49.7±0.3%, respectively, which were 2.1 and 1.9 times higher than that of the hot-water extract. The cytotoxicity of BAE to B16F0 cells was analyzed using MTT assay, and no inhibition of cell growth was confirmed below 1 mg/mL. To study the mechanism of melanin synthesis for confirming the skin-whitening effects of BAE, the mRNA levels of tyrosinase related protein-1 (TRP-1) and protein-2 (TRP-2) were compared using a reverse transcription-polymerase chain reaction. The BAE reduced the expressions of TRP-1 and TRP-2, by 1.4 and 2.1 times, respectively, compared to HAE, proving that BAE is effective in inhibiting melanin synthesis. The bioconversion of BAE using L. plantarum showed enhanced UV-absorption and skin-whitening effects. Thus, BAE can be used as a multi-functional cosmetic ingredient with both UV-absorption and skin-whitening functions.

Keywords: Angelica gigas, Lactiplantibacillus plantarum, UV-absorption, skin-whitening, bioconversion

서 론

멜라닌(melanin)은 표피의 기저층에 존재하는 멜라닌세포의 멜라닌소체에서 타이로시나제와 타이로시나제 관련 단백질(tyrosinase related protein, TRP)에 의해 생성되며 수지상 돌기를 통해 각질세포로 이동하여 피부색을 띠게 하고 자외선으로부터 피부세포를 보호하는 역할을 한다(Lee, 2021; Choi 등, 2014). 멜라닌 생성의 주요 효소로 알려진 타이로시나제는 폴리페놀 산화효소의 일종으로 타이로신을 도파(dopa)와 도파퀴논(dopaquinone)으로 변환시키고 도파퀴논의 자동산화에 의해 도파크롬(dopachrome)으로 변화시킨다(Seo 등, 2010). 도파크롬은 TRP-2에 의해 산화되어 5,6-dihydroxyindole-2-carboxylic acid로 변화되며, 최종적으로 TRP-1의 촉매에 의해 황적색을 나타내는 페오멜라닌과 흑색을 나타내는 유멜라닌이 합성되고 피부, 머리카락과 눈동자의 색깔 등을 결정하게 된다(Kim 등, 2018; Lee와 Song, 2004). 표피 최외각의 각질세포에 존재하는 멜라닌이 자외선에 노출되면 여기 상태(excited state)가 되고 다시 기저 상태(ground state)로 복원되면서 흡수했던 에너지를 열에너지로 방출하여 자외선으로부터 피부를 보호하고 체온을 유지하는 등 중요한 기능을 수행하게 된다(Im, 2008; Lee, 1996). 반면 과도한 자외선 노출, 피부 내 활성산소 증가, 스트레스와 염증 반응 등에 의해 멜라닌이 과량 합성되면 색소침착에 따른 기미나 주근깨 등을 유발하므로 보다 효과적인 미백 효과를 위해서는 피부에 흡수되는 자외선 차단과 동시에 TRP 계열 단백질의 활성 저해가 병행되어야 한다(Park 등, 2019; Kwon 등, 2014).

멜라닌 생성을 촉진하는 자외선은 태양광선의 전자파장에 따라 UV-A(장파장, 320~400 nm), UV-B(중파장, 28 ~320 nm)와 UV-C(단파장, 200~280 nm)로 분류된다(Kim과 Lee, 2016). UV 스펙트럼 중 생물에게 가장 위험한 UV-C 스펙트럼의 대부분은 대기상층의 산소 분자에 의해 성층권의 오존에 흡수되어 지상에 도달하지 않으나, 오존에 의해 50% 흡수되는 UV-A는 피부를 침투해 피폭에 의한 즉시형 색소침착을 발생시켜 피부 흑화나 광노화를 유발하며, 오존에 90% 이상 흡수되는 UV-B는 고에너지 준위에 의한 일광화상을 통해 홍반을 유발하여 자연형 색소침착을 일으키게 된다(Lee 등, 2003; Chang, 2016; Jeong 등, 2011). 또한, 지속해서 자외선에 노출된 피부세포는 다량의 활성산소를 발생시키고 세포 내 단백질, 지질 및 DNA의 손상을 일으켜 피부암의 원인이 된다(Lee 등, 2001). 따라서 자외선으로부터 피부를 보호하기 위한 자외선 흡수제 필요성이 증가하고 있으며 세계 시장 규모는 2021년 7,620억 원으로 유기와 무기 자외선 흡수제가 각각 78%와 22%로 시장을 형성하고 있다(Kim과 Nam, 2021). 2021년부터 미국을 중심으로 유기 자외선 흡수제에 사용되는 옥티녹세이트와 옥시벤존의 사용을 금지하는 법안이 발효되어 무기 자외선 흡수제의 사용이 증가할 것으로 예상되나 무기 자외선 흡수제의 주요 원료인 이산화티탄, 파라아미노안식향산과 벤조페논의 피부 자극성, 피부 과민 반응과 백탁 현상 등의 부작용으로 인해 상기 물질을 포함하지 않은 천연물 소재 자외선 흡수제의 수요가 급증할 것으로 전망되고 있다(Park 등, 2005; Kim 등, 2002).

당귀(Angelica gigas)는 미나리과에 속하는 다년생 초본으로 전 세계적으로 광범위하게 재배되고 있으며 한방에서 혈액 순환을 도와 빈혈이나 부인병 등에 대한 보혈제로 민간에서 널리 사용되는 약재이다(Oh 등, 1999; Kim 등, 2013). 기존 연구에 따르면 당귀 추출물의 생리활성물질은 데커시놀, 움벨리페론, 쿠마린과 베타시토스테롤 등으로 항염증, 항암과 항산화 효과가 높다고 알려져 있다(Choi 등, 2012; Sung과 Kim, 2005). 또한, 당귀 추출물의 주요성분인 데커신과 데커신의 이성질체인 데커시놀은 혈행 및 인지 개선 효과가 있어 노화로 저하된 인지기능과 만성 퇴행성 질환 개선에 도움을 주는 물질로 식품의약품안전처(식약처)의 개별인정형 원료로 인증받아 관절 기능성식품과 치매 치료제로 개발이 진행되고 있다(Kim 등, 2019; Lee 등, 2008). 최근 미백 화장품 소재로 개발되고 있는 일부 약용식물 유래 추출물은 멜라닌세포에 대해 독성을 나타낸다는 보고가 있어 균주를 이용한 발효를 통해 추출물의 세포독성을 경감시키려는 연구가 지속되고 있으며, 이에 발효과정에서 생산되는 효소에 의한 천연물의 생물전환을 통해 저분자화에 따른 배당체, 핵산 및 펩타이드 등의 생리활성물질을 생산하는 기술이 개발되는 추세이나 현재까지 당귀 열수 추출물 생물전환을 통한 미백 및 UV 흡수 효과 증진에 관한 연구는 미흡한 실정이다(Che 등, 2010; Sim 등, 2021). 본 연구에서는 김치에서 분리한 Lactiplantibacillus plantarum SM4를 이용해 당귀 열수 추출물을 생물전환하여 타이로시나제 저해 효과와 자외선 흡수 효과를 비교하고 TRP-1과 TRP-2의 유전자 발현에 미치는 영향평가를 통해 멜라닌 생성 저해 기전을 규명하고자 하였다. 이를 위해 최근 국내 식・의약품 산업에서 널리 이용되고 있는 생물전환 기술을 이용하여 당귀 추출물의 자외선 흡수 및 피부 미백 활성 증진 효과를 평가하여 당귀의 향장 소재화를 위한 기초자료를 제공하고자 하였다.

재료 및 방법

실험 재료

본 연구에서는 2020년도에 강원도 평창에서 생산된 당귀를 라이프스토리(Yongin, Korea)에서 건조물로 구매하여 사용하였으며, 분석에 이용된 시약인 tyrosinase from mushroom, 3,4-dihydroxyphenylalanine(L-DOPA)과 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoliumbromide(MTT) 등은 Sigma-Aldrich(St. Louis, MO, USA)에서 구매하였다. 세포 배양을 위한 시약인 Dulbecco’s modified Eagle medium(DMEM), fetal bovine serum(FBS)과 trypsin은 Gibco(Waltham, MA, USA)의 제품을 사용하였으며, 균주 배양을 위한 Difco MRS 배지는 BD Biosciences(Sparks, NV, USA)에서 구매하여 이용하였다. 그 외 실험에 사용된 모든 분석 시약들은 Sigma-Aldrich의 일급(EP) 이상 시약을 사용하였다.

당귀 열수 추출

당귀 열수 추출물 제조를 위해 건조된 시료 1.0 g에 1차 증류수 10.0 mL를 첨가하여 초음파 추출기(SD-D250H, Sungdong Co., Hwaseong, Korea)를 이용해 40 kHz와 200 W로 60.0°C에서 30분간 추출을 진행하였다. 추출 후 원심분리기(Lobogene 1236R, Gyrozen, Daejeon, Korea)를 이용하여 4.0°C, 5,000 rpm과 10분간 고액 분리하고 상등액을 취하여 -21.0°C에 보관하면서 필요에 따라 희석하여 실험에 이용하였다.

균주 분리

당귀 열수 추출물 생물전환을 위한 균주는 김치로부터 분리하였고 배양을 위해 Difco MRS 배지를 사용하여 고체와 액체배지를 각각 제조하였다. 균주 분리를 위해 1:100으로 희석한 김칫국물 0.1 mL를 MRS 평판배지에 도말하여 37.0°C 항온기에서 24시간 배양하였으며, 백금이를 이용해 단일 집락을 선별하여 균을 MRS 배지에 접종하여 항온기에서 48시간 배양하였다. 이후 베타-글루코시데이즈 활성이 높은 균주를 선발하기 위해 API ZYM kit(BioMerieux, Marcy-l’Étoile, France)을 이용하여 베타-글루코시데이즈 효소 활성을 검사하였다.

당귀 열수 추출물 생물전환

생물전환을 위해 본 연구실에서 김치로부터 분리한 L. plantarum SM4를 사용하였다. 배양을 위해 MRS 액체배지를 제조하고 1 M HCl과 1 M NaOH로 pH를 7.0으로 조정하고 엘렌마이어 플라스크(Erlenmeyer flask)에 분주하여 고압멸균기(SAC05060P, Daehan Sci., Wonju, Korea)에서 121.0°C로 15분간 멸균하여 배양 배지를 제조하였다. 멸균된 배지에 12시간 배양한 종균 1.0%를 접종하여 진탕배양기에서 37.0°C, 150 rpm으로 24시간 배양 진행 후 생물전환을 위해 당귀 열수 추출물과 배양액을 1:2 비율로 혼합하고 초기 pH를 5.0으로 조정하여 진탕배양기에서 37.0°C와 150 rpm으로 48시간 효소 분해를 진행하였다. 조효소액 생산을 위해 호모게나이저(HG-15A, Daehan Sci.)를 이용해 세포를 파쇄하였으며, 1 M HCl과 1 M NaOH를 이용하여 최종 pH를 5.0으로 조정하고 진탕배양기에서 45.0°C, 150 rpm과 48시간 추가적인 효소 분해를 진행 후 4.0°C에서 5,000 rpm으로 10분간 원심분리하여 생물전환물을 획득한 후 분석실험에 이용하였다.

타이로시나제 활성 저해율 측정

당귀 열수 추출물과 생물전환물의 타이로시나제 활성 저해율은 Kim 등(2012)의 분석법을 변형하여 측정하였다. 완충용액은 monobasic anhydrous와 dibasic anhydrous를 혼합하여 pH 6.8로 제조하였으며 완충용액을 이용하여 10 mM 기질액(L-DOPA)을 제조하였다. 시료 0.2 mL에 완충용액 0.4 mL, 기질액 0.2 mL와 타이로시나제(125 unit/mL) 0.2 mL를 첨가하여 실온에서 20분간 반응을 진행하였으며 대조군에는 시료 대신 증류수를 첨가하였다. 반응 후 분광광도계(Mecasys Co., Daejeon, Korea)를 이용해 475 nm에서 흡광도를 측정하고 타이로시나제 활성 저해율은 아래 식에 따라 L-ascorbic acid를 양성대조군으로 하여 백분율로 산출하였다.

(%)=1AB×100A: , B:

자외선 흡수율 측정

당귀 열수 추출물과 생물전환물의 자외선 흡수율을 비교하기 위해 열수 추출물과 생물전환물의 상등액을 증류수로 각각 50배 희석한 후 분광광도계를 이용하여 UV-A, UV-B와 UV-C 스펙트럼 구간인 200~400 nm에서 흡수율을 측정하였다. 대조군으로는 향장용 자외선 흡수제인 disodium phenyl dibenzimidazole(DPD, 0.1 mg/mL)을 사용하여 흡수율 비교를 통해 아래 식을 이용해 백분율로 산출하였다.

(%)=1AB×100A: , B:

세포 배양

당귀 생물전환물이 세포 성장에 미치는 영향과 TRP 유전자 기반 미백 활성 기전 규명을 위한 실험 수행을 위해 마우스 유래 B16F0(흑색종세포)를 생물자원센터(Jeongeup, Korea)에서 분양받아 사용하였다. 세포 배양을 위해 10.0% FBS와 1.0% penicillin이 포함된 DMEM 배지를 사용하였으며 B16F0를 배양 플라스크에 5.0×104 cells/mL로 분주하여 동물세포 배양기(SA-MCO-18AIC, Sanyo Co., Osaka, Japan)에서 37.0°C와 5.0% CO2를 유지하며 배양하였다.

세포독성 평가

당귀 생물전환물의 세포독성 평가를 위해 MTT 분석법에 기반하여 B16F0를 1.0×104 cells/mL로 96-well plate에 0.18 mL씩 분주하여 24시간 배양하였다. 당귀 생물전환물을 DMEM 배지에 희석하여 B16F0에 농도별로 0.02 mL씩 분주하였으며, 대조군에는 생물전환물 대신 DMEM 배지를 첨가하여 72시간 배양하였다. 배지를 제거한 후 0.25 mg/mL MTT 시약을 0.1 mL 처리하여 동물세포 배양기에서 4시간 반응 후 시약을 제거하고 dimethyl sulfoxide 0.1 mL를 첨가한 후 마이크로 플레이트 리더(Infinite® 200, Tecan Group Ltd., Männedorf, Switzerland)를 이용하여 450 nm에서 흡광도를 측정하였다. 세포 생존율은 아래의 식을 이용하여 백분율로 산출하였다.

%=1AB×100A: , B:

당귀 생물전환물의 미백 효과 확인을 위해 관련 주요 유전자 발현을 평가하였다. 세포 배양을 위해 24-well plate에 1.0×105 cells/mL로 세포를 분주하고 당귀 생물전환물을 농도별로 처리하여 세포 배양기에서 24시간 배양하고 세포 회수를 위해 trypsin-EDTA를 처리한 후 2,000 rpm에서 2분간 원심분리하였다. 회수된 세포는 Accuprep® universal RNA extraction kit(Bioneer, Daejeon, Korea)을 이용해 total RNA를 추출하였고 ER 완충용액을 대조군으로 흡광도를 측정해 total RNA를 정량하였다. 추출한 RNA 1.0 µg에 2×cDNA synthesis 완충용액과 cDNA synthesis enzyme mix를 혼합한 후 diethylpyrocarbonate를 이용해 전체 부피가 20.0 µL가 되도록 PCR 튜브에 첨가한 후 각각 TRP-1과 TRP-2를 역전사 방법으로 증폭하였으며, 발현 평가를 위한 대조군으로 하우스키핑 유전자인 β-actin을 이용하였다. 실험에 사용된 프라이머 염기서열을 Table 1에 요약하였으며 모든 mRNA의 증폭 과정은 95.0°C에서 10분간 초기 변성을 진행하고 95.0°C에서 30초의 변성반응과 72.0°C에서 30초간 연장반응을 실시하였다. 결합반응 온도는 TRP-1과 TRP-2에서 각각 60.0°C와 54.0°C였으며 PCR 산물들은 gel red® nucleic acid gel stain(Komabiotech, Seoul, Korea) 10.0 µL를 첨가하고 1.5% 아가로스 겔에 전기영동 한 후 Geldoc(BioRad, Hercules, CA, USA)을 이용하여 유전자 발현을 확인하였다.

Table 1 . Primer design to evaluate the expression levels of major genes related to melanin production.

PrimerForward (5'-3')Reverse (5'-3')Size (bp)
TRP-1GCTGCAGGAGCCTTCTTTCTCAAGACGCTGCACTGCTGGTCT398
TRP-2AGAAGTTTGACAGCCCTCCCTAACCGCAGAGCAACTTG360
β-ActinACTACCTCATGAAGATCCTGTTGCTGATCCACATCTGCTG731


통계분석

통계분석을 위해 모든 실험은 3 반복 수행하였으며 실험값은 평균표준편차로 나타내었다. 통계적 검증은 Graphpad Prism software(San Deigo, CA, USA)를 이용하였으며, 각 실험군의 유의성 평가는 independent t-test를 이용해 분석하였고 전체 실험군의 유의성 평가는 일변수 분산분석을 이용해 분석하여 P<0.05를 기준으로 실험군 간의 유의성을 평가하였다.

결과 및 고찰

자외선 흡수율 측정

지표면에 도달하는 자외선은 UV-A, UV-B와 UV-C로 분류되며 피부 진피층 투과를 통해 DNA 손상 및 활성산소종을 생성하는 원인으로, 멜라닌세포 내 타이로시나제의 활성화를 통해 멜라닌 생성을 유도하여 피부 흑화, 색소침착, 광노화는 물론 피부암을 유발해 자외선 흡수제 개발에 있어 UV의 흡수율이 중요한 평가지표이다(Kim 등, 1994; Hwang 등, 2013; Shin 등, 1996). 당귀 열수 추출물과 생물전환물의 자외선 효과 평가를 위해 UV 전 영역에서 흡수율을 비교했을 때 두 실험군 모두 UV-B 구간에서 가장 높은 흡수율을 보였으며, 300 nm UV-B에 대해 DPD 대비 26.20.9%와 49.70.3%의 흡수 효과가 확인되어 당귀 추출물과 생물전환물을 이용한 UV 흡수제 개발에 있어 DPD 대체를 통해 부작용이 저감된 천연 소재로 활용이 가능할 것으로 사료된다. 자외선 중 UV-B는 피부의 색소침착을 유발하여 표면의 유연성이 저하되고 만성적으로 노출되면 피부세포 내의 산화반응이 촉진되어 노화와 육종 현상이 유발되기 때문에, UV-B 흡수를 통한 피부보호를 위한 인체 안전성이 높은 천연 유래 성분으로부터 유용한 항산화 물질을 찾는 연구가 지속되는 추세이다. 이에 비해 UV-C 영역인 270 nm에서 24.20.7%와 40.41.9%의 흡수율이 확인되어 추출물과 생물전환물이 UV-B와 UV-C의 효과적인 흡수제로 작용함을 알 수 있었다. 특히, 두 영역에서 흡수 효과를 비교했을 때 열수 추출물 대비 생물전환물에서 1.9배와 1.7배가 증가하여 당귀 추출물의 발효에 의해 UV 흡수율이 높아짐이 확인되었다(Fig. 1). 이러한 증진 효과는 추출물 내의 결합형으로 존재하는 폴리페놀과 같은 생리활성물질이 생물전환에 의해 가수분해되어 저분자의 유리형 펩타이드, 비당체 또는 핵산 등으로 전환됨에 따라 UV-B와 UV-C의 흡수 효과가 증진된 것으로 예측된다(Kim 등, 2021; Hong 등, 2021). 본 연구에서 당귀 열수 추출물의 생물전환을 통해 UV-B와 UV-C 흡수율 증가가 확인됨에 따라 미백 활성 증진에 효과가 있을 것으로 사료되며, 이를 검증하기 위해 타이로시나제 활성 저해 평가, 세포독성 평가와 미백 활성 기전 규명에 관한 추가적인 연구가 필요할 것으로 판단된다.

Fig 1. Comparison of changes in UV-absorbance profiles of BAE and HWE. Results are expressed as mean±standard deviation (n=3) (A). Comparison of absorbance of HWE and BAE compared to DPD in UV-A range (B). Comparison of absorbance of HWE and BAE compared to DPD in UV-B range (C). Comparison of absorbance of HWE and BAE compared to DPD in UV-C range (D). HWE: hot water extract, BAE: bioconverted A. gigas extract.

타이로시나제 활성 저해율 측정

타이로신은 타이로시나제에 의해 멜라닌 생성의 전구체가 되는 도파와 도파퀴논으로 대사되므로 타이로시나제의 저해를 통해 피부의 멜라닌 생성 감소에 따른 미백 효과를 기대할 수 있다(Choi 등, 2006). 당귀 열수 추출물과 생물전환물의 미백 활성을 평가하기 위해 멜라닌 생성의 주요 효소인 타이로시나제 활성 저해율을 비교한 결과 각각 24.8±0.2%와 51.7±0.6%로 나타나 생물전환물에서 2.1배 증가한 것을 확인하였으며, L. plantarum SM4를 이용한 생물전환을 통해 타이로시나제 활성 저해를 증가시킴에 따른 미백 효과 증진이 가능함을 확인하였다(Fig. 2). 이는 Lee 등(2018)의 연구에서 보리 씨앗 열수 추출물과 L. brevis를 이용한 생물전환물의 타이로시나제 활성 저해율이 각각 39.1±0.03%와 47.9±0.02%로 나타나 본 연구의 타이로시나제 활성 저해가 각각 1.6배와 1.1배 우수함이 입증되었다. 기존 대마 씨 미백 활성 연구에서 L. plantarum을 이용한 생물전환에 있어 폴리페놀과 플라보노이드 함량이 열수 추출물 대비 1.1배와 1.6배 증가하였으며, 폴리페놀 함량과 타이로시나제 활성이 반비례한다는 Yoon 등(2018)의 결과에 기반할 때 생물전환물의 폴리페놀 화합물이 티로시나제와 기질인 타이로신의 효소 결합에 있어 경쟁적 저해제(competitive inhibitor)로 작용하여 멜라닌 생합성 단계에서 티로시나제의 활성을 저해하고 타이로신의 산화를 억제함으로써 미백 효과가 증가한 것으로 예측된다(Yoon 등, 2018; Kim, 2009).

Fig 2. Comparison of tyrosinase activity inhibition of HWE and BAE. Results are expressed as mean±standard deviation (n=3). HWE: hot water extract, BAE: bioconverted A. gigas extract.

세포독성 평가

당귀 생물전환물이 멜라닌 생성의 주요 유전자인 TRP-1과 TRP-2 발현에 미치는 영향을 평가하기에 앞서 세포성장 최소 억제농도를 확인하기 위해 B16F0에 당귀 생물전환물을 농도별(0.0~4.0 mg/mL)로 처리하여 세포 생존율을 조사했을 때, 당귀 생물전환물의 농도가 세포 생존율에 유의한 영향을 미치며 농도 의존적으로 생존율이 감소하는 것을 확인하였다(P<0.05). 생물전환물을 1.0과 2.0 mg/mL 처리했을 때 세포 생존율이 대조군 대비 97.8±0.3%(P=0.0546)와 89.6±0.5%(P=0.0032)로 나타나 1.0 mg/mL 이하의 농도에서 세포성장을 저해하지 않는 것으로 확인되었다(Fig. 3). 당귀 생물전환물 처리에 따른 TRP-1과 TRP-2의 발현 저해와 멜라닌 생성 저해 기전 규명을 평가하기 위해 세포성장 최소 억제농도인 1.0 mg/mL로 생물전환물 처리농도를 결정하여 멜라닌 생성의 핵심 유전자 발현 확인을 위한 RT-PCR 실험을 진행하였다.

Fig 3. Inhibitory effects of HWE and BAE concentrations on cell growth of B16F0. Cells were incubated after adding different concentrations of HWE and BAE. The cell growth of the nontreated group (N.T.) was represented as 100% of cell viability. Results are expressed as mean±standard deviation (n=3). *P<0.05.

유전자 발현 평가

멜라닌은 타이로시나제, TRP-1과 TRP-2에 의해 아미노산의 일종인 타이로신을 도파와 도파퀴논으로 전환한 후 자동산화 과정과 단백질 중합반응에 의해 합성되므로 천연물 유래 미백 물질 탐색에 있어 타이로시나제, TRP-1과 TRP-2의 저해를 통한 멜라닌 생성 감소 효과를 중심으로 연구가 활발히 진행되고 있다(Yu 등, 2015). 생물전환물이 B16F0 성장 저해에 따른 유전자 발현에 미치는 영향을 최소화하고자 앞선 세포독성 평가에 기반하여 B16F0에 무독한 농도인 0.0~1.0 mg/mL에서 TRP-1과 TRP-2의 발현도를 평가하였다. 당귀 생물전환물 처리 시 농도 증가에 따라 TRP-1과 TRP-2의 발현이 감소하였으며, 1.0 mg/mL 첨가 시 각각 1.4배와 2.1배로 유의하게 감소한 것으로 확인되었다(P<0.05, Fig. 4). 이러한 결과는 Lee 등(2013)의 미백 소재 추출 연구에서 타이로시나제 활성 저해가 높았던 노간주나무 추출물이 B16F10에서 TRP-1과 TRP-2의 발현을 감소시킨다는 결과와 유사함이 확인되었다. 미백 소재 개발에 있어 TRP-1과 TRP-2 발현 저해는 중요한 요소로 당귀 생물전환물이 멜라닌 생성의 주요 효소인 TRP-1과 TRP-2의 활성 저해를 통한 멜라닌 생성 감소로 미백 효과가 증진됨이 확인되었다.

Fig 4. The expressions of β-actin, TRP-1, and TRP-2 in B16F0 cells treated with BAE were evaluated. β-Actin was used as internal control.

요 약

당귀 열수 추출물로부터 미백 및 자외선 흡수 효과를 가지는 생리활성물질 추출 및 효과 증진을 위해 김치에서 분리한 L. plantarum SM4를 이용하여 생물전환을 수행하고 미백 기능성을 평가하였다. 당귀 생물전환물의 UV-B 흡수 효과와 타이로시나제 활성 저해율을 평가했을 때 각각 49.70.3%와 51.71.9%로 당귀 열수 추출물 대비 1.9배와 2.1배 증가함이 확인되어 L. plantarum SM4를 이용한 생물전환을 통해 저분자화된 유리형 생리활성물질에 의해 자외선 흡수와 미백에 효과가 증대되었음을 확인할 수 있었다. 세포독성 검사에서 당귀 생물전환물 1.0 mg/mL 이하 농도에서 B16F0에 대한 무독성이 확인되어 당귀 생물전환물이 피부에 안전한 자외선 흡수와 미백 소재로써 활용이 가능할 것으로 결론지을 수 있다. 관련 기전 규명을 위해 멜라닌 생성 저해의 핵심 유전자인 TRP-1과 TRP-2의 발현도를 평가했을 때 당귀 생물전환물 농도 증가에 따라 유전자 발현이 유의적으로 감소한 것을 확인하였다. 따라서 본 연구는 당귀 추출물의 L. plantarum SM4를 이용한 생물전환물이 피부에 흡수되는 자외선 흡수 감소와 함께 자외선에 의한 멜라닌 생성을 저해가 가능한 효과적인 미백 기능성 화장품 소재로 활용 가능할 것으로 기대된다.

Fig 1.

Fig 1.Comparison of changes in UV-absorbance profiles of BAE and HWE. Results are expressed as mean±standard deviation (n=3) (A). Comparison of absorbance of HWE and BAE compared to DPD in UV-A range (B). Comparison of absorbance of HWE and BAE compared to DPD in UV-B range (C). Comparison of absorbance of HWE and BAE compared to DPD in UV-C range (D). HWE: hot water extract, BAE: bioconverted A. gigas extract.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 412-418https://doi.org/10.3746/jkfn.2022.51.5.412

Fig 2.

Fig 2.Comparison of tyrosinase activity inhibition of HWE and BAE. Results are expressed as mean±standard deviation (n=3). HWE: hot water extract, BAE: bioconverted A. gigas extract.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 412-418https://doi.org/10.3746/jkfn.2022.51.5.412

Fig 3.

Fig 3.Inhibitory effects of HWE and BAE concentrations on cell growth of B16F0. Cells were incubated after adding different concentrations of HWE and BAE. The cell growth of the nontreated group (N.T.) was represented as 100% of cell viability. Results are expressed as mean±standard deviation (n=3). *P<0.05.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 412-418https://doi.org/10.3746/jkfn.2022.51.5.412

Fig 4.

Fig 4.The expressions of β-actin, TRP-1, and TRP-2 in B16F0 cells treated with BAE were evaluated. β-Actin was used as internal control.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 412-418https://doi.org/10.3746/jkfn.2022.51.5.412

Table 1 . Primer design to evaluate the expression levels of major genes related to melanin production.

PrimerForward (5'-3')Reverse (5'-3')Size (bp)
TRP-1GCTGCAGGAGCCTTCTTTCTCAAGACGCTGCACTGCTGGTCT398
TRP-2AGAAGTTTGACAGCCCTCCCTAACCGCAGAGCAACTTG360
β-ActinACTACCTCATGAAGATCCTGTTGCTGATCCACATCTGCTG731

References

  1. Chang MH. Research on the change of hair by an ultraviolet A. Journal of the Korean Society of Design Culture. 2016. 22:561-568.
  2. Che JY, Yang HJ, Jeong JJ, Seo WS, Park JS, Ok M, et al. Tyrosinase inhibition activity and antioxidant capacity by fermented products of some medicinal plants. J Life Sci. 2010. 20:940-947.
    CrossRef
  3. Choi CH, Wang KT, Cho HR, Jeong JG, Jeong HW. Inhibitory effects of Saposhnikoviae Radix extracts on the melanin production and elastase activity in B16F10 cells. J Orient Physiol Pathol. 2014. 28:296-302.
    CrossRef
  4. Choi SW, Kim EO, Leem HH, Kim JK. Anti-inflammatory effects of volatile flavor extracts from Cnidium officinale and Angelica gigas. J Korean Soc Food Sci Nutr. 2012. 41:1057-1065.
    CrossRef
  5. Choi SY, Kang NJ, Kim HC. Inhibitory effects of root extracts on melanin biosynthesis in Rodgersia podophylla A. Gray. Korean J Medicinal Crop Sci. 2006. 14:27-30.
  6. Hong JW, Park HY, Kim JH, Yeom SH, Kim JW. Antioxidation and anti-photoaging effects of white Taraxacum coreanum extract by Lactobacillus plantarum. Journal of the Korea Academia-Industrial cooperation Society. 2021. 22:554-562.
  7. Hwang SY, Lee JT, Kim YU, Kim HJ. Skin whitening effects of extracts from Angelicae gigantis Radix and Lycii fructus ethanol extracts. Herb Formula Sci. 2013. 21:91-98.
    CrossRef
  8. Im NK. Decomposition of melanin chromophore by phenolic solution. Master’s thesis. Chosun University, Gwangju, Korea. 2008.
  9. Jeong HR, Jo YN, Jeong JH, Jin DE, Song BG, Heo HJ. Whitening and anti-wrinkle effects of apple extracts. Korean J Food Preserv. 2011. 18:597-603.
    CrossRef
  10. Kim DM, Kim KH, Kim YS, Koh JH, Lee KH, Yook HS. A study on the development of cosmetic materials using unripe peaches seed extracts. J Korean Soc Food Sci Nutr. 2012. 41:110-115.
    CrossRef
  11. Kim GY, Lee SJ, Jeon MJ, Kim BM, Kim GT, Kang SM, et al. The evaluation of niacinamide-dipeptide convergence as skin whitening materials. KSBB J. 2018. 33:19-25.
    CrossRef
  12. Kim HY, Lee KY, Kim TH, Park AR, Noh HS, Kim SC, et al. Development and validation of analytical method for decursin in aerial parts of Angelica gigas Nakai extract. J Food Hyg Saf. 2019. 34:52-57.
    CrossRef
  13. Kim J, Lee DY, Sung SH, Kim J. Geographical classification of Angelica gigas using UHPLC-DAD combined multivariate analyses. Kor J Pharmacogn. 2013. 44:332-335.
  14. Kim JW, Suh SK, Choi JY, Park CW, Seo KW, Kim KB, et al. Studies on the correlation between SPF index and skin irritation index of sunscreens. J Appl Pharmacol. 2002. 10:246-252.
  15. Kim SS, Kim SD, Cho KM. A study on UV-CUT processing. J Kor Soc Dyers Finishers. 1994. 6(3):52-59.
  16. Kim SY, Gam DH, Kim JH, Yeom SH, Park JH, Kim JW. Enhancement of antioxidant and skin cancer inhibition effects by fermented Luffa aegyptiaca extract. Journal of the Korea Academia-Industrial cooperation Society. 2021. 22:408-414.
  17. Kim YH, Lee JS. Growth and contents of anthocyanins and ascorbic acid in lettuce as affected by supplemental UV-A LED irradiation with different light quality and photoperiod. Korean J Hortic Sci Technol. 2016. 34:596-606.
    CrossRef
  18. Kim YJ, Nam GW. Comparative analysis of UV protection factor measurement methods for each country and factors affecting UV protection factor. J Soc Cosmet Sci Korea. 2021. 47:193-203.
  19. Kim YJ. Evaluation of antioxidant activity and thermal stability of plant polyphenols. Biomater Res. 2009. 13:30-36.
  20. Kwon EJ, Park HJ, Kim MM, Lee KR, Hong I, Lee DG, et al. Effect of Ulmus macrocapa ethanolic extracts on anti-oxidant activity and melanin synthesis in B16F1 cells. J Life Sci. 2014. 24:946-951.
    CrossRef
  21. Lee EH, Lee JK, Hong JT, Jung KM, Kim YK, Lee SH, et al. Protective effect of green tea extract, catechin on UVB-induced skin damage. J Food Hyg Saf. 2001. 16:117-124.
  22. Lee EW, Song HR. A study on hair coloring useing natural vegetable dye. J Fash Bus. 2004. 8:125-135.
  23. Lee JH, Yoon YC, Kim JK, Park YE, Hwang HS, Kwon GS, et al. Antioxidant and whitening effects of the fermentation of barley seeds (Hordeum vulgare L.) using lactic acid bacteria. J Life Sci. 2018. 28:444-453.
  24. Lee KT, Lee BY, Won YI, Jee JB, Lee WH, Kim YJ. Radiative properties at King Sejong Station in West Antarctica with the radiative transfer model: A surface UV-A and erythemal UV-B radiation changes. Ocean Polar Res. 2003. 25:9-20.
    CrossRef
  25. Lee KY, Sung SH, Kim YC. Cognitive-enhancing activity of decursin derivatives. Kor J Pharmacogn. 2008. 39:86-90.
  26. Lee MS. B16F10 mouse cell to identify the enhancement of melanin synthesis of lincomycin. Master’s thesis. Jeju National University, Jeju, Korea. 2021.
  27. Lee S. Melanogenesis and its control. Proceedings of the Society of Cosmetic Scientists of Korea Symposium. 1996 Jul 1. Korea. p 22-32.
  28. Lee SY, Jun HJ, Lee JY. Down-regulation of tyrosinase, MITF, TRP-1, and TRP-2 expressions by Juniperus rigida Sieb. in murine B16F10 melanoma. J Life Sci. 2013. 23:1445-1453.
    CrossRef
  29. Oh SH, Cha YS, Choi DS. Effects of Angelica gigas Nakai diet on lipid metabolism, alcohol metabolism and liver function of rats administered with chronic ethanol. J Korean Soc Agric Chem Biotechnol. 1999. 42:29-33.
  30. Park JY, Lee HN, Hu MY, Park JH. Kojic acid derivatives, have tyrosinase inhibitory activity to suppress the production of melanin in the biosynthetic pathway. J Life Sci. 2019. 29:755-761.
  31. Park SH, Ahn JH, Moon KK, Bae DH, Kim MS, Lee S, et al. Study on the in vitro sun protection factor effect of nanosuspensions prepared using bead mill and high pressure homogenizer. J Kor Pharm Sci. 2005. 35:411-416.
    CrossRef
  32. Seo EJ, Hong ES, Choi MH, Kim KS, Lee SJ. Antioxidant and skin whitening effects of Rhamnus yoshinoi extracts. Korean J Food Sci Technol. 2010. 42:750-754.
  33. Shin DC, Lee JT, Chung Y, Kang NK, Yang JY. Application of the health risk models estimating skin cancer caused by UVB radiation. Kor J Environ Toxicol. 1996. 11:1-10.
  34. Sim JH, Lee KM, Park T, Kang MS, Hong H, Kim SY. Biorenovation-assisted modification of Ligustrum japonicum extract for skin-whitening effect. KSBB J. 2021. 36:30-35.
    CrossRef
  35. Sung KC, Kim KJ. Tyrosinase activated inhibition effect & analysis of pine-needles extract. J Korean Oil Chemists’ Soc. 2005. 22:71-76.
  36. Yoon YC, Kim BK, Kim JK, Lee JH, Park YE, Kwon GS, et al. Verification of biological activities and tyrosinase inhibition of ethanol extracts from hemp seed (Cannabis sativa L.) fermented with lactic acid bacteria. J Life Sci. 2018. 28:688-696.
  37. Yu JM, Kim DH, Son JH. whitening effects of solvent fractions isolated from Vitex rotundifolia. J Appl Biol Chem. 2015. 53:266-271.
    CrossRef