검색
검색 팝업 닫기

Ex) Article Title, Author, Keywords

JKFN Journal of the Korean Society of Food Science and Nutrition



Online ISSN 2288-5978

Article

home All Articles View

Article

Split Viewer

Journal of the Korean Society of Food Science and Nutrition 2022; 51(5): 403-411

Published online May 31, 2022 https://doi.org/10.3746/jkfn.2022.51.5.403

Copyright © The Korean Society of Food Science and Nutrition.

Effect of Barley β-Glucan on Osteoblast Differentiation and Molecular Mechanism

Hyeon-Oh Kim , Young-Ju Lim , and Won-Gu Jang

Department of Biotechnology, College of Engineering, and Research of Institute of Anti-Aging, Daegu University

Correspondence to:Won-Gu Jang, Department of Biotechnology, College of Engineering, Daegu University, 201, Daegudae-ro, Jillyang-eup, Gyeongsan, Gyungbuk 38453, Korea, E-mail: jangwg@daegu.ac.kr
Author information: Hyeon-Oh Kim (Researcher), Young-Ju Lim (Researcher), Won-Gu Jang (Professor)

Received: January 19, 2022; Revised: April 13, 2022; Accepted: April 13, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

The fiber found in oats and barley is a polysaccharide β-glucan. Barley β-glucan (BBG) is reported to effectively attenuate the glycemic response and reduce post-prandial blood glucose levels. However, the function of BBG in osteogenic differentiation remains unclear. In this study we investigate that the effect of BBG on osteoblast differentiation in a pre-osteoblast cell line and mouse calvaria primary cells. RT-PCR and western blot analysis revealed that exposure to BBG increases the mRNA expressions and protein levels of distal-less homeobox 5 and runt-related transcription factor 2. Furthermore BBG also increases p38, Smad1/5/9 phosphorylation and mineralization. We confirmed the regenerative effect of BBG on caudal fin in zebrafish by applying Alizarin Red staining analysis. Taken together, these results indicate that BBG increases osteogenic differentiation via activation of p38 MAPK-mediated Smad1/5/9 in MC3T3-E1 cells and mouse calvaria primary cells.

Keywords: p38 MAPK, Smad1/5/9, barley β-glucan, osteoblast differentiation, MC3T3-E1 cells

β-Glucan은 포도당(glucose)이 β-(1,3), β-(1,4) 또는 β-(1,6) 결합으로 구성된 다당류로, 보리 및 귀리와 같은 곡류의 세포벽에서 발견되고 조류(algae), 버섯, 균류, 박테리아 같은 다양한 organism에도 함유되어 있다(Volman 등, 2008; Du 등, 2019; Rahar 등, 2011; Schwartz와 Vetvicka, 2021). β-Glucan은 잘 알려진 biologic response modifiers로 감염성 질환 및 암에 대한 면역조절제(immunostimulants) 역할을 담당하고 있으며(Brown과 Gordon, 2003; Yun 등, 2003; Zeković 등, 2005), 인체의 면역반응을 조절하여 항암효과를 가지는 것으로 알려져 있다(Han 등, 2014; Chan 등, 2009). 또한, barley β-glucan은 미국식품의약국(FDA)의 1일 섭취 권장량이 3~5 g으로, 혈중 콜레스테롤 및 중성지방의 수치를 낮추고 혈압을 감소시키는 효과를 나타낸다는 보고가 있다(Karmally 등, 2005; Liu 등, 1999; Vetvicka과 Vetvickova, 2009; Lattimer와 Haub, 2010; Lee 등, 2015).

뼈는 일생 재형성되는 역동적인 조직으로 뼈의 항상성 조절에 중요한 역할을 새로운 뼈를 형성하는 조골세포와 오래된 뼈를 제거해주는 파골세포가 담당하고 있다(Shin과 Cho, 2005; Mori, 2017; Sims 등, 1996; Eriksen, 2010; Chen 등, 2018). 조골세포는 중간엽 줄기세포로부터 분화되고 조골세포 분화는 증식, 세포외 기질의 성숙 및 무기질화 단계를 거치게 되며, 다양한 신호전달경로를 통해 조절된다(Hwang 등, 2009; Minguell 등, 2001; Bermúdez-Reyes 등, 2018). 조골세포 분화는 transforming growth factor β(TGF-β) superfamily의 구성원인 bone morphogenetic protein 2(BMP2)에 의해 자극되어 Smad 신호전달경로를 통해(Suda 등, 1995) 다양한 호르몬 및 distal-less homobox 5(Dlx5), runt-related transcription factor 2(Runx2)와 같은 다양한 전사인자에 의해 조절된다(Ryoo 등, 2006; Heo 등, 2016; Simeone 등, 1994). In vitro에서 Alizarin Red 염색은 extracellular matrix에 calcium apatite가 침착된 mineralization 수준을 확인할 수 있다(Declercq 등, 2005). 조골세포 분화에서 mineralization은 중요한 역할을 담당하고 있다는 보고가 있다(Ahmad 등, 1999; Wu 등, 2021).

Mitogen-activated protein kinase(MAPK)는 증식, 스트레스 반응, 세포 사멸 및 분화와 같은 세포 내 중요한 신호들을 조절하는 것으로 알려져 있다(Cargnello와 Roux, 2011; Zhang과 Liu, 2002; Ai 등, 2016; Sun 등, 2015; Buscà 등, 2016; Cuadrado와 Nebreda, 2010; Liu와 Lin, 2005). MAPK는 extracellular signal-regulated kinase (ERK), c-Jun N-terminal protein kinase(JNK) and p38 MAPK로 구성되어 있다. p38의 활성화는 중간엽 줄기세포에서부터 분화된 근육세포, 지방세포, 연골세포, 조골세포와 같은 다양한 세포의 분화를 유도한다는 보고가 있다(Lai 등, 2001; Liao 등, 2002; Leiva 등, 2020; Takebe 등, 2011). p38은 초기 조골세포 분화에 중요한 역할을 담당하고 있다고 알려져 있다(Greenblatt 등, 2013). p38 인산화는 조골세포 전사인자 유전자를 활성 및 발현을 증가시켜 골 형성 진행을 촉진한다는 보고가 되어있다(Greenblatt 등, 2010). Calvaria organ cultures에서 p38 inhibitor(SB203580)를 처리하여 p38의 억제를 통해 mineralization을 감소시키는 연구가 보고된 바가 있다(Ge 등, 2012).

본 연구는 barley β-glucan이 조골세포 분화에 어떤 영향을 미치는지 확인하였다. 이를 분석하기 위해 조골 전구세포 MC3T3-E1 cells와 mouse calvaria primary cells에 barley β-glucan 처리를 통해 조골세포 분화 유전자 발현과 조골세포 분화 유전자 및 p38, Smad1/5/9의 단백질 수준을 확인하고 칼슘 침착을 통해 조골세포 분화의 분자적 기전을 확인하였다.

실험 재료 및 시약

본 실험에 사용된 MC3T3-E1(subclone 4 CRL 2593) 세포는 American Type Culture Collection(Manassas, VA, USA)에서 구입하였다. α-MEM, penicillin streptomycin, calf serum은 Gibco BRL(Grand Island, NY, USA)에서 구입하였고, fetal bovine serum은 Merck(New Jersey, MA, USA)에서, barley β-glucan(G6513; BBG), ascorbic acid, β-glycerophosphate, ponceau, skim milk, Alizarin Red는 Sigma Aldrich(St. Louis, MO, USA)에서 구입하여 사용하였다. TRI-solution은 Bioscience Technology(Gyeongsan, Korea)에서 구입하였고, TOP scriptTM RT Dry MIX는 Enzynomics(Daejeon, Korea)에서, Emerald Amp GT PCR Master Mix는 TaKaRa(Tokyo, Japan)에서 구입하여 사용하였다. RIPA buffer는 ATTO (Tokyo, Japan)에서 구입하여 사용하였고, polyvinylidene fluoride(PVDF) membrane은 Roche(Basel, Switzerland)에서, AmershamTM ECL은 Cytiva(Incheon, Korea)에서 구입하여 사용하였다. p38 inhibitor(SB203580)는 InvivoGen(San Diego, CA, USA)에서, 1차 항체 p-Smad1/5/9, p-p38 and t-p38은 Cell Signaling Technology(Danvers, MA, USA)에서 구입하여 사용하였다. Dlx5는 Abcam(Cambridge, UK)에서, Smad1, Runx2, β-actin과 2차 항체 anti-rabbit IgG, anti-mouse IgG는 Santa Cruz Biotechnology(Dallas, Texas, USA)에서 구입하여 사용하였다.

세포 배양

MC3T3-E1 세포 유지 시에는 α-MEM 배지에 10% calf serum과 1% 항생제(100 U/mL penicillin-100 μg/mL streptomycin)를 첨가하여 37°C, 5% CO2 조건으로 배양하였다. MC3T3-E1 cells를 35 mm dish와 24-well plate에 배양하여 80% 포화하게 되면 5 μM BBG와 5 mM β-glycerophosphate, 50 μg/mL ascorbic acid가 포함된 배지로 2일마다 배지를 교체하면서 분화를 유도하였다.

유전자 발현 분석법(RT-PCR analysis)

조골세포에 BBG(5 μM)를 처리하여 1, 2, 4일 배양하였다. 배양한 세포는 dPBS로 세척하고 TRI-solutionTM을 이용하여 MC3T3-E1 cells에서 총 RNA를 추출 및 분리하였다. cDNA는 제조사의 지시에 따라 TOP scriptTM RT Dry MIX를 사용하여 total RNA로부터 합성되었다. PCR 반응 조건은 95°C에서 10분, 95°C에서 30초, annealing 온도에서 30초, 72°C에서 30초 후 다시 95°C에서 30초 돌아가는 cycle을 반복하고 72°C에서 5분 진행하였다. 중합효소 반응에 사용된 primer 정보는 Table 1에 나타내었다.

Table 1 . Specific primers for RT-PCR

GeneFoward primerReverse primer
Dlx5GAGAAGAGTCCCAAGCATCCGAGCGCTTTGCCATAAGAAG
Runx2CCGCACGACAACCGCACCATCGCTCCGGCCCACAAATCTC
β-actinTTCTTTGCAGCTCCTTCGTTGCCGTGGATGGCTACGTACATGGCTGGG


단백질 발현 분석법(western blot analysis)

35 mm dish에서 배양한 MC3T3-E1 세포에 BBG를 처리한 샘플을 RIPA buffer를 사용하여 단백질을 회수하였다. 추출한 단백질은 Bradford 방법(Jain, 2017)으로 정량하였다. 동일한 양의 단백질을 sample buffer에 첨가하여 100°C에서 5분 동안 끓인 후, SDS polyacrylamide gel electrophoresis를 수행하였다. 전기영동이 끝난 gel 상의 단백질은 transfer 장치를 이용하여 PVDF membrane에 단백질을 이동시켰다. 단백질이 잘 이동하였는지 확인하기 위하여 ponceau 염색을 하였고, 확인 후 Tris-buffered saline with Tween 20(TBST) buffer로 세척하였다. Membrane을 5% skim milk로 blocking 한 후, 1차 항체를 4°C에서 overnight 하여 반응시켰다. TBST로 10분씩 4번 세척 후 2차 항체를 반응시켰다. 다시 TBST로 10분씩 4번 세척 후, AmershamTM ECL reagent 1과 reagent 2를 1:1로 혼합하여 단백질의 발현을 확인하였다.

골의 석회화 측정(Alizarin Red S 염색)

MC3T3-E1 세포를 24-well plate에 well 당 5×104개로 접종하여 BBG를 처리하여 3주간 배양하였다. 그 후 배지를 제거하고 dPBS로 세척하여 4% formaldehyde로 5분간 실온에서 고정시켰다. 세포의 고정이 끝난 후 2% Alizarin Red solution으로 20분간 염색하고 3차 증류수로 세척 후 Epson Perfection V37 scanner(EPSON, Nagano, Japan)를 통해 이미지화하였다.

실험동물

Mouse calvaria primary cells isolation을 하기 위해 사용된 ICR mouse는 12시간 낮/밤 주기와 20~22°C, 습도 50~60% 조건에서 유지하고 물과 사료는 자유롭게 섭취하도록 하였다(Kim 등, 2020). Zebrafish(Danio rerio) 길이 3.4~4.4 cm zebrafish를 수조(300 mL, 한 수조당 3마리)에서 30±1°C 12시간의 낮/밤 주기를 유지하여 사육했다. Artemia nauplii(Artemia salina)와 Tetra bits complete를 매일 급여했으며 물은 2일마다 교체했다. 골 재생을 확인하기 위해 zebrafish는 3~5초 냉수에서 기절시킨 후, 꼬리지느러미의 아랫부분을 절단했다. 본 실험은 대구대학교 실험동물관리 및 이용위원회(DUIACUC-12020/4-0313-006)의 승인을 받아 진행하였다.

Mouse calvaria primary cells isolation

생후 2일 된 ICR mouse의 두개골을 적출하였다. 적출된 두개골은 HBSS(Cytiva, Seoul, Korea)와 함께 0.1% collagenase D(Roche) 및 0.2% dispase(Gibco)를 20분 incubator에서 반응시켜 상층액을 수집하였다. 이 단계를 5회 반복하였다. 1,800 rpm에서 8분 동안 사용하여 mouse calvaria primary cells를 얻었다.

Zebrafish ARS 염색

BBG(5 μM)에 대한 골 재생을 확인하기 위해 Alizarin Red S 염색을 진행했다. 수조에 있는 zebrafish에 BBG를 처리하여 사육 조건에 맞춰 6일 동안 사육했다. Zebrafish를 고정하기 위해 24시간 동안 10% formaldehyde 용액을 사용해서 고정하였다. Mineralization의 시각화를 증가시키기 위해서 zebrafish를 1% KOH 및 3% hydrogen peroxide로 12시간 동안 침연시켰다. 그 후 zebrafish에 25% sodium tetraborate를 2시간 동안 처리하고, 물로 세척한 뒤 Alizarin Red 염색을 하였다.

통계처리

본 연구에서 얻은 결과는 표준오차로 표시하였고, 통계처리는 GraphPad Prism 5(GraphPad Software Inc., San Diego, CA, USA)에서 Student's t-test를 이용하였으며, P<0.05인 경우 대조군과 BBG 처리군 사이에 유의성이 있음을 인정하였다.

BBG가 조골세포 분화에 미치는 영향

MC3T3-E1은 murine calvaria pre-osteoblast cell line으로 뼈 연구에서 대표적인 세포로 알려져 있다(Hwang과 Horton, 2019; Wang 등, 1999). 이전 연구에서 BBG는 파골세포 분화를 억제한다는 보고가 있다(Ariyoshi 등, 2021). MC3T3-E1 subclone 4 세포는 세포주이며 pre-osteoblast like cells maturation으로 조골세포 기질의 무기질화를 연구하는 데 사용된다. 조골세포 분화 유전자를 발현하고 ascorbic acid에 의해 mineralization 된 세포 외 기질을 형성한다(Franceschi와 Iyer, 1992). Mouse calvaria primary cell은 neonatal mouse의 두개골 조직에서 분리된 세포이며, 조직의 특성을 가지고 있다. 안정적인 표현형이 발현되어 primary cell의 실험 결과가 세포주 실험 결과보다 더 신뢰받는다. 그러나 primary cell은 장기간 배양하게 되면 세포주에 비해 제한된 증식 활동으로 인해 세포의 수가 감소한다(Liu 등, 2019). 본 연구의 MC3T3-E1 세포 및 mouse calvaria primary cells에서 BBG(Fig. 1)의 조골세포 분화 효과를 확인하고자 RT-PCR 분석과 western blot 분석을 통해 BBG의 처리 농도 및 처리 시간에 따른 조골세포 분화 유전자 Dlx5, Runx2의 유전자 발현과 단백질 수준을 분석하였다. BBG 처리 농도에 따른 결과로 MC3T3-E1 세포에서는 Dlx5, Runx2의 유전자 발현이 농도 의존적으로 증가하며(Fig. 2A upper panel), mouse calvaria primary cells(primary cells)에는 Dlx5, Runx2의 유전자 발현이 1 μM에서 높게 발현되었다(Fig. 2A lower panel). 다음으로 MC3T3-E1 세포에서 BBG 농도별 처리에 의한 Dlx5, Runx2의 단백질 수준을 확인하였다. 그 결과로 Dlx5, Runx2의 단백질 발현이 5 μM 농도에서 유의하게 증가하였다(Fig. 2B). 다음은 BBG의 처리 시간에 따른 Dlx5, Runx2 유전자의 발현 수준을 확인하였다. MC3T3-E1 세포에서 Dlx5 발현은 2일 차에, Runx2는 4일 차에 발현이 증가하였으며, primary cells에서는 Dlx5, Runx2의 유전자 발현이 시간 의존적으로 유의하게 증가하는 것으로 나타났다(Fig. 2C). MC3T3-E1 세포에서 Dlx5는 2일 차에, Runx2는 4일 차에 단백질 발현이 증가하였고, primary cells에서 Dlx5는 2일 차, Runx2는 1일 차에 유의하게 증가하는 것으로 나타났다(Fig. 2D). Alizarin Red 염색은 식물성 염료로 무기질화된 세포외 기질에 특이적으로 결합을 한다(Redlich 등, 2002). 이를 통해 세포 외 기질에 침착된 칼슘의 양을 알 수 있다(Maeda 등, 2001; Schiller 등, 2001). BBG 처리를 통해 칼슘 침착이 증가하는 것을 확인할 수 있다(Fig. 2E). 이러한 결과를 통해 BBG가 조골세포 분화를 증가시키는 것으로 판단된다.

Fig. 1. Structure of barley β-glucan.

Fig. 2. The effect of barley β-glucan (BBG) on osteogenic differentiation of MC3T3-E1 cells and mouse calvaria primary cells. (A) MC3T3-E1 cells and mouse calvaria primary cells were incubated 0.5, 1, and 5 μM BBG for 2 days. (B) MC3T3-E1 cells were incubated 0.5, 1, and 5 μM BBG (5 μM) for 2 days. (C) Cells were treated BBG (5 μM) for 1, 2, and 4 days, after which cells were harvested for total RNA isolation, confirmed by RT-PCR analysis of Dlx5, Runx2, and β-actin mRNA expression. (D) MC3T3-E1 cells and mouse calvaria primary cells were treated BBG (5 μM) for 1, 2, and 4 days. Western blot analysis of Dlx5, Runx2, and β-actin protein levels. (E) MC3T3-E1 cells were treated with BBG (5 μM), 50 μg/mL ascorbic acid (AA), and 5 mM β-glycerophosphate (β-GP) for 2 weeks on calcium deposition. The graph has shown using ImageJ. *P<0.05 and **P<0.01 compared to the untreated control, respectively. Results were presented as mean±SEM (n≥3).

BBG가 p38 인산화에 미치는 효과

p38 MAPK 활성화는 primary calvaria osteoblast cells 및 bone marrow osteoprogenitor cells, stromal cell lines 분화에 중요한 역할이 보고되어 있다(Wang 등, 2007). 본 연구에서는 western blot 분석을 통해 BBG에 의한 p38의 발현을 확인하였다. 그 결과 BBG 처리를 통해 p38의 단백질 발현이 60분까지 시간 의존적으로 증가하였다가 120분부터 감소하는 것으로 나타났다(Fig. 3A). 다음으로 p38 억제제(SB203580)를 처리하여 조골세포 유전자 발현을 확인하기 위해 RT-PCR 분석을 통해 확인하였다. MC3T3-E1 및 primary cells에서 BBG의 단독처리 시 Dlx5, Runx2 유전자 발현이 증가하였으나, BBG와 SB203580을 함께 처리하면 Dlx5, Runx2 유전자 발현이 감소함을 확인하였다(Fig. 3B). 또한, 단백질 발현 분석을 통해 MC3T3-E1 세포에서 BBG 처리로 증가한 p-p38 단백질 발현이 SB203580과 함께 처리한 그룹에서 p-p38이 감소하는 것으로 나타났다(Fig. 3C). BBG 처리에 의한 칼슘 침착을 확인하기 위해 Alizarin Red 염색을 수행하였다. BBG 5 μM의 처리로 칼슘 침착이 유의하게 증가하였고, BBG와 SB203580을 함께 처리했을 때 칼슘 침착이 감소하는 것으로 나타났다(Fig. 3D). 이를 통해 BBG 단독처리가 Dlx5, Runx2와 p38의 단백질 발현과 Dlx5, Runx2 유전자 발현이 증가하였지만, SB203580 처리를 통해 Dlx5, Runx2 유전자의 발현과 Dlx5, Runx2 및 p38의 단백질 발현을 감소시키는 결과를 확인하였다. 본 연구에서 BBG가 p38 신호전달경로를 통해 조골세포 분화를 조절하는 것으로 판단된다.

Fig. 3. Effects of p38 inhibition on barley β-glucan (BBG)-induced osteogenic differentiation. (A) MC3T3-E1 cells were treated BBG (5 μM) for 0∼240 min and p-p38, t-p38, and β-actin confirmed by western blot analysis. (B) MC3T3-E1 cells and mouse calvaria primary cells were treated with BBG (5 μM) and SB203580 (20 μM) for 2 days and Dlx5, Runx2, and β-actin mRNA expression confirmed by RT-PCR analysis. (C) MC3T3-E1 cells were treated BBG (5 μM) and SB203580 (20 μM) for 0.5 h and p-p38, t-p38, and β-actin protein levels confirmed by western blot analysis. (D) MC3T3-E1 cells were incubated with BBG (5 μM) and SB203580 (20 μM) for 2 weeks and ARS staining was performed to determine calcium deposition. The graph has shown using ImageJ. *P<0.05 and **P<0.01 compared to the untreated control, #P<0.05 compared to the BBG treated respectively. Results were presented as mean±SEM (n≥3).

BBG가 Smad1/5/9 인산화에 미치는 효과

R-Smad는 receptor regulated Smads이며, 세포 내 신호전달의 mediator로 Smad 단백질은 TGF-β 신호에 의해 자극이 되면 세포질에 있는 Smad는 인산화되어 핵에 축적되어 표적 유전자 발현을 조절하는 역할을 한다(Xu, 2006). BBG 처리에 의한 Smad1/5/9의 단백질 발현을 확인하기 위해 western blot 분석을 진행하였다. 분석을 통해 MC3T3-E1 세포에서 p-Smad1/5/9의 단백질 발현이 30분까지 증가하다가 60분부터 감소하는 것을 확인하였다(Fig. 4A). 그리고 MC3T3-E1과 primary cells에 SB203580 처리 후 Smad1/5/9의 인산화를 확인하였다. 두 세포 모두 BBG 단독처리 그룹에서 Smad1/5/9의 인산화가 증가하고, SB203580을 함께 처리한 그룹에서 감소하는 것을 나타내었다(Fig. 4B). 본 연구에서는 BBG 단독처리로 Smad1/5/9의 인산화가 증가하고 p38 억제제(SB203580) 처리에 의해 Smad1/5/9의 인산화가 감소하는 결과를 나타내었다. 이 결과는 BBG가 p38 신호전달경로를 통해 Smad1/5/9의 인산화를 조절하여 조골세포 분화를 증가시킴을 시사한다.

Fig. 4. Barley β-glucan (BBG) increased phosphorylation of Smad1/5/9. (A) MC3T3-E1 cells were treated BBG (5 μM) 0∼240 min, western blot analysis were performed to measure the protein levels of p-Samd1/5/9, t-Smad, and β-actin. (B) MC3T3-E1 cells and mouse calvaria primary cells were treated BBG (5 μM) and SB203580 (20 μM) for 0.5 h and p-Smad1/5/9, t-Samd1, and β-actin protein levels confirmed by western blot analysis. The graph has shown using ImageJ. *P<0.05 compared to the untreated control respectively. Results were presented as mean±SEM (n≥3).

BBG가 성체 zebrafish의 골 재형성에 미치는 영향

Zebrafish 꼬리지느러미는 조골세포 분화에 의해 재생된다는 것을 대변한다(Lim 등, 2021). In vitro 연구 결과에서 BBG가 조골세포 분화 유전자 발현과 단백질 수준을 증가시키는 것을 확인하였다. 그래서 BBG가 골 재생을 증가시키는 효능이 있을 것이라는 가정을 하였다. In vivo 상에서 BBG의 효과를 확인하기 위해 성체 zebrafish에 BBG(5 μM, 50 μM)를 처리하였고 대조군과 비교하였다. 그 결과 BBG를 처리하여 Alizarin Red 염색을 통해 성체 zebrafish의 꼬리지느러미의 골 형성을 확인하였다. 그러나 50 μM BBG 처리그룹보다 5 μM BBG 처리그룹에서 골 형성의 유의적인 증가를 확인하였다(Fig. 5A). 본 연구에서 BBG가 성체 zebrafish의 꼬리지느러미의 골 형성 효과를 보이는 것을 확인하였다. 종합해보면 BBG가 p38 MAPK 신호전달경로의 활성화를 통해 Smad1/5/9가 인산화되어 MC3T3-E1 cells와 mouse calvaria primary cells에서 Dlx5, Runx2 발현을 상향 조절하여 조골세포 분화를 촉진한다(Fig. 5B).

Fig. 5. Barley β-glucan (BBG) increased regeneration zebrafish caudal fin rays. (A) Caudal fin rays of adult zebrafish were amputated at 0 day and ARS staining was analyzed. Total caudal-fin rays and the enlarged part are shown at the top and bottom, respectively. Caudal fin rays of adult zebrafish were quantitated and compared between the control group and BBG (5 and 50 μM) group treatment with 7 days. The zebrafish image was taken from the picture gallery site. The graph has shown using ImageJ. **P<0.01 compared to the untreated control. (B) Molecular mechanism of BBG promotes Dlx5 and Runx2 genes via activated p38 MAPK-mediated, Smad1/5/9 in MC3T3-E1 cells and mouse calvaria primary cells.

본 연구에서는 barley β-glucan(BBG)이 조골세포 분화에 미치는 영향을 조사하였다. 조골 전구세포주인 MC3T3-E1 cells와 mouse calvaria primary cells에서 BBG를 처리하여 실험을 진행하였다. MC3T3-E1 cells 및 mouse calvaria primary cells에서 BBG를 처리하여 RT-PCR 분석법을 통해 Dlx5, Runx2 유전자 발현을 증가시키는 것을 확인하였다. Western blot 분석법을 통해 Dlx5, Runx2와 p-p38, p-Smad1/5/9 단백질 발현이 증가하는 것도 확인하였다. 또한, Alizarin Red 염색으로 BBG 처리에 의해 칼슘 침착이 증가하는 것을 확인하였다. 그뿐만 아니라 BBG에 의해 증가한 Dlx5와 Runx2 유전자 및 단백질 발현과 p-p38, p-Smad 1/5/9의 단백질 발현이 p38 억제제(SB203580) 처리로 감소한 것을 확인하였다. 이를 통해 BBG가 p38 신호전달경로를 통해 조골세포 분화를 증가시키는 것을 확인하였다. Zebrafish에 BBG를 처리한 후 Alizarin Red 염색을 통해 절단된 꼬리지느러미의 재생이 증가한 것을 확인하였다. 본 연구를 종합해보면 BBG가 조골세포 분화를 증가시켜 골 질환 치료제로 사용될 수 있음을 시사한다.

  1. Ahmad M, McCarthy M, Gronowicz G. An in vitro model for mineralization of human osteoblast-like cells on implant materials. Biomaterials. 1999. 20:211-220.
    CrossRef
  2. Ai X, Yan J, Carrillo E, Ding W. The stress-response MAP kinase signaling in cardiac arrhythmias. Rev Physiol Biochem Pharmacol. 2016. 172:77-100.
    Pubmed KoreaMed CrossRef
  3. Ariyoshi W, Hara S, Koga A, Nagai-Yoshioka Y, Yamasaki R. Biological effects of β-glucans on osteoclastogenesis. Molecules. 2021. 26:1982. https://doi.org/10.3390/molecules26071982
    Pubmed KoreaMed CrossRef
  4. Bermúdez-Reyes B, Lara-Banda MR, Reyes-Zarate E, Rojas-Martínez A, Camacho A, Moncada-Saucedo N, et al. Effect on growth and osteoblast mineralization of hydroxyapatite-zirconia (HA-ZrO2) obtained by a new low temperature system. Biomed Mater. 2018. 13:035001. https://doi.org/10.1088/1748-605X/aaa3a4
    Pubmed CrossRef
  5. Brown GD, Gordon S. Fungal β-glucans and mammalian immunity. Immunity. 2003. 19:311-315.
    CrossRef
  6. Buscà R, Pouysségur J, Lenormand P. ERK1 and ERK2 map kinases: Specific roles or functional redundancy?. Front Cell Dev Biol. 2016. 4:53. https://doi.org/10.3389/fcell.2016.00053
    Pubmed KoreaMed CrossRef
  7. Cargnello M, Roux PP. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol Mol Biol Rev. 2011. 75:50-83.
    Pubmed KoreaMed CrossRef
  8. Chan GCF, Chan WK, Sze DMY. The effects of β-glucan on human immune and cancer cells. J Hematol Oncol. 2009. 2:25. https://doi.org/10.1186/1756-8722-2-25
    Pubmed KoreaMed CrossRef
  9. Chen X, Wang Z, Duan N, Zhu G, Schwarz EM, Xie C. Osteoblast-osteoclast interactions. Connect Tissue Res. 2018. 59:99-107.
    Pubmed KoreaMed CrossRef
  10. Cuadrado A, Nebreda AR. Mechanisms and functions of p38 MAPK signalling. Biochem J. 2010. 429:403-417.
    Pubmed CrossRef
  11. Declercq HA, Verbeeck RMH, De Ridder LIFJM, Schacht EH, Cornelissen MJ. Calcification as an indicator of osteoinductive capacity of biomaterials in osteoblastic cell cultures. Biomaterials. 2005. 26:4964-4974.
    Pubmed CrossRef
  12. Du B, Meenu M, Liu H, Xu B. A concise review on the molecular structure and function relationship of β-glucan. Int J Mol Sci. 2019. 20:4032. https://doi.org/10.3390/ijms20164032
    Pubmed KoreaMed CrossRef
  13. Eriksen EF. Cellular mechanisms of bone remodeling. Rev Endocr Metab Disord. 2010. 11:219-227.
    Pubmed KoreaMed CrossRef
  14. Franceschi RT, Iyer BS. Relationship between collagen synthesis and expression of the osteoblast phenotype in MC3T3-E1 cells. J Bone Miner Res. 1992. 7:235-246.
    Pubmed CrossRef
  15. Ge C, Yang Q, Zhao G, Yu H, Kirkwood KL, Franceschi RT. Interactions between extracellular signal-regulated kinase 1/2 and p38 MAP kinase pathways in the control of RUNX2 phosphorylation and transcriptional activity. J Bone Miner Res. 2012. 27:538-551.
    Pubmed KoreaMed CrossRef
  16. Greenblatt MB, Shim JH, Glimcher LH. Mitogen-activated protein kinase pathways in osteoblasts. Annu Rev Cell Dev Biol. 2013. 29:63-79.
    Pubmed CrossRef
  17. Greenblatt MB, Shim JH, Zou W, Sitara D, Schweitzer M, Hu D, et al. The p38 MAPK pathway is essential for skeletogenesis and bone homeostasis in mice. J Clin Invest. 2010. 120:2457-2473.
    Pubmed KoreaMed CrossRef
  18. Han MD, Kim YH, Kim WJ. In vivo growth inhibition of sarcoma-180 cells by a β-glucan from the mushroom Ganoderma lucidum. J Life Sci. 2014. 24:721-727.
    CrossRef
  19. Heo JS, Choi Y, Kim HS, Kim HO. Comparison of molecular profiles of human mesenchymal stem cells derived from bone marrow, umbilical cord blood, placenta and adipose tissue. Int J Mol Med. 2016. 37:115-125.
    Pubmed KoreaMed CrossRef
  20. Hwang NS, Zhang C, Hwang YS, Varghese S. Mesenchymal stem cell differentiation and roles in regenerative medicine. Wiley Interdiscip Rev Syst Biol Med. 2009. 1:97-106.
    Pubmed CrossRef
  21. Hwang PW, Horton JA. Variable osteogenic performance of MC3T3-E1 subclones impacts their utility as models of osteoblast biology. Sci Rep. 2019. 9:8299. https://doi.org/10.1038/s41598-019-44575-8
    Pubmed KoreaMed CrossRef
  22. Jain A. Protein measurement using Bradford assay and photopette®. Tip Biosystems. 2017. p 1-3.
  23. Karmally W, Montez MG, Palmas W, Martinez W, Branstetter A, Ramakrishnan R, et al. Cholesterol-lowering benefits of oat-containing cereal in Hispanic Americans. J Am Diet Assoc. 2005. 105:967-970.
    Pubmed CrossRef
  24. Kim KM, Son HE, Min HY, Jang WG. Vitexin enhances osteoblast differentiation through phosphorylation of Smad and expression of Runx2 at in vitro and ex vivo. Mol Biol Rep. 2020. 47:8809-8817.
    Pubmed CrossRef
  25. Lai CF, Chaudhary L, Fausto A, Halstead LR, Ory DS, Avioli LV, et al. Erk is essential for growth, differentiation, integrin expression, and cell function in human osteoblastic cells. J Biol Chem. 2001. 276:14443-14450.
    Pubmed CrossRef
  26. Lattimer JM, Haub MD. Effects of dietary fiber and its components on metabolic health. Nutrients. 2010. 2:1266-1289.
    Pubmed KoreaMed CrossRef
  27. Lee SH, Jang GY, Hwang IG, Kim HY, Woo KS, Kim KJ, et al. Physicochemical properties of β-glucan from acid hydrolyzed barley. Prev Nutr Food Sci. 2015. 20:110-118.
    Pubmed KoreaMed CrossRef
  28. Leiva M, Matesanz N, Pulgarín-Alfaro M, Nikolic I, Sabio G. Uncovering the role of p38 family members in adipose tissue physiology. Front Endocrinol. 2020. 11:572089. https://doi.org/10.3389/fendo.2020.572089
    Pubmed KoreaMed CrossRef
  29. Liao P, Wang SQ, Wang S, Zheng M, Zheng M, Zhang SJ, et al. p38 mitogen-activated protein kinase mediates a negative inotropic effect in cardiac myocytes. Circ Res. 2002. 90:190-196.
    Pubmed KoreaMed CrossRef
  30. Lim YJ, Kim KM, Jang WG. Chrysophanol increases osteoblast differentiation via AMPK/Smad1/5/9 phosphorylation in vitro and in vivo. Clin Exp Pharmacol Physiol. 2021. 48:515-523.
    Pubmed CrossRef
  31. Liu B, Lu Y, Wang Y, Ge L, Zhai N, Han J. A protocol for isolation and identification and comparative characterization of primary osteoblasts from mouse and rat calvaria. Cell Tissue Bank. 2019. 20:173-182.
    Pubmed KoreaMed CrossRef
  32. Liu J, Lin A. Role of JNK activation in apoptosis: A double-edged sword. Cell Res. 2005. 15:36-42.
    Pubmed CrossRef
  33. Liu S, Stampfer MJ, Hu FB, Giovannucci E, Rimm E, Manson JE, et al. Whole-grain consumption and risk of coronary heart disease: results from the nurses’ health study. Am J Clin Nutr. 1999. 70:412-419.
    Pubmed CrossRef
  34. Maeda T, Matsunuma A, Kawane T, Horiuchi N. Simvastatin promotes osteoblast differentiation and mineralization in MC 3T3-E1 cells. Biochem Biophys Res Commun. 2001. 280:874-877.
    Pubmed CrossRef
  35. Minguell JJ, Erices A, Conget P. Mesenchymal stem cells. Exp Biol Med. 2001. 226:507-520.
    Pubmed CrossRef
  36. Mori S. Aging and homeostasis. Aging of bone. Clin Calcium. 2017. 27:917-923.
  37. Rahar S, Swami G, Nagpal N, Nagpal MA, Singh GS. Preparation, characterization, and biological properties of β-glucans. J Adv Pharm Technol Res. 2011. 2:94-103.
    Pubmed KoreaMed CrossRef
  38. Redlich K, Hayer S, Ricci R, David JP, Tohidast-Akrad M, Kollias G, et al. Osteoclasts are essential for TNF-α-mediated joint destruction. J Clin Invest. 2002. 110:1419-1427.
    Pubmed KoreaMed CrossRef
  39. Ryoo HM, Lee MH, Kim YJ. Critical molecular switches involved in BMP-2-induced osteogenicdifferentiation of mesenchymal cells. Gene. 2006. 366:51-57.
    Pubmed CrossRef
  40. Schiller PC, D’ippolito G, Balkan W, Roos BA, Howard GA. Gap-junctional communication is required for the maturation process of osteoblastic cells in culture. Bone. 2001. 28:362-369.
    CrossRef
  41. Schwartz B, Vetvicka V. Review: β-glucans as effective antibiotic alternatives in poultry. Molecules. 2021. 26:3560. https://doi.org/10.3390/molecules26123560
    Pubmed KoreaMed CrossRef
  42. Shin CS, Cho HY. Bone remodeling and mineralization. J Korean Soc Endocrinol. 2005. 20:543-555.
    CrossRef
  43. Simeone A, Acampora D, Pannese M, D’Esposito M, Stornaiuolo A, Gulisano M, et al. Cloning and characterization of two members of the vertebrate Dlx gene family. Proc Natl Acad Sci U S A. 1994. 91:2250-2254.
    Pubmed KoreaMed CrossRef
  44. Sims NA, Morris HA, Moore RJ, Durbridge TC. Increased bone resorption precedes increased bone formation in the ovariectomized rat. Calcif Tissue Int. 1996. 59:121-127.
    Pubmed CrossRef
  45. Suda T, Udagawa N, Nakamura I, Miyaura C, Takahashi N. Modulation of osteoclast differentiation by local factors. Bone. 1995. 17:S87-S91.
    CrossRef
  46. Sun Y, Liu WZ, Liu T, Feng X, Yang N, Zhou HF. Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J Recept Signal Transduction. 2015. 35:600-604.
    Pubmed CrossRef
  47. Takebe K, Nishiyama T, Hayashi S, Hashimoto S, Fujishiro T, Kanzaki N, et al. Regulation of p38 MAPK phosphorylation inhibits chondrocyte apoptosis in response to heat stress or mechanical stress. Int J Mol Med. 2011. 27:329-335.
    Pubmed CrossRef
  48. Vetvicka V, Vetvickova J. Effects of yeast-derived β-glucans on blood cholesterol and macrophage functionality. J Immunotoxicol. 2009. 6:30-35.
    Pubmed CrossRef
  49. Volman JJ, Ramakers JD, Plat J. Dietary modulation of immune function by β-glucans. Physiol Behav. 2008. 94:276-284.
    Pubmed CrossRef
  50. Wang D, Christensen K, Chawla K, Xiao G, Krebsbach PH, Franceschi RT. Isolation and characterization of MC3T3-E1 preosteoblast subclones with distinct in vitro and in vivo differentiation/mineralization potential. J Bone Miner Res. 1999. 14:893-903.
    Pubmed CrossRef
  51. Wang X, Goh CH, Li B. p38 mitogen-activated protein kinase regulates osteoblast differentiation through osterix. Endocrinology. 2007. 148:1629-1637.
    Pubmed CrossRef
  52. Wu X, Dai H, Yu S, Zhao Y, Long Y, Li W, et al. Citrate regulates extracellular matrix mineralization during osteoblast differentiation in vitro. J Inorg Biochem. 2021. 214:111269. https://doi.org/10.1016/j.jinorgbio.2020.111269
    Pubmed CrossRef
  53. Xu L. Regulation of Smad activities. Biochim Biophys Acta, Gene Struct Expression. 2006. 1759:503-513.
    Pubmed KoreaMed CrossRef
  54. Yun CH, Estrada A, Van Kessel A, Park BC, Laarveld B. β-Glucan, extracted from oat, enhances disease resistance against bacterial and parasitic infections. FEMS Immunol Med Microbiol. 2003. 35:67-75.
    CrossRef
  55. Zeković DB, Kwiatkowski S, Vrvić MM, Jakovljević D, Moran CA. Natural and modified (1→3)-β-D-glucans in health promotion and disease alleviation. Crit Rev Biotechnol. 2005. 25:205-230.
    Pubmed CrossRef
  56. Zhang W, Liu HT. MAPK signal pathways in the regulation of cell proliferation in mammalian cells. Cell Res. 2002. 12:9-18.
    Pubmed CrossRef

Article

Article

Journal of the Korean Society of Food Science and Nutrition 2022; 51(5): 403-411

Published online May 31, 2022 https://doi.org/10.3746/jkfn.2022.51.5.403

Copyright © The Korean Society of Food Science and Nutrition.

Barley β-Glucan 처리에 의한 조골세포 분화의 분자적 기전

김현오․임용주․장원구

대구대학교 생명공학과, 항노화연구소

Received: January 19, 2022; Revised: April 13, 2022; Accepted: April 13, 2022

Effect of Barley β-Glucan on Osteoblast Differentiation and Molecular Mechanism

Hyeon-Oh Kim , Young-Ju Lim , and Won-Gu Jang

Department of Biotechnology, College of Engineering, and Research of Institute of Anti-Aging, Daegu University

Correspondence to:Won-Gu Jang, Department of Biotechnology, College of Engineering, Daegu University, 201, Daegudae-ro, Jillyang-eup, Gyeongsan, Gyungbuk 38453, Korea, E-mail: jangwg@daegu.ac.kr
Author information: Hyeon-Oh Kim (Researcher), Young-Ju Lim (Researcher), Won-Gu Jang (Professor)

Received: January 19, 2022; Revised: April 13, 2022; Accepted: April 13, 2022

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

The fiber found in oats and barley is a polysaccharide β-glucan. Barley β-glucan (BBG) is reported to effectively attenuate the glycemic response and reduce post-prandial blood glucose levels. However, the function of BBG in osteogenic differentiation remains unclear. In this study we investigate that the effect of BBG on osteoblast differentiation in a pre-osteoblast cell line and mouse calvaria primary cells. RT-PCR and western blot analysis revealed that exposure to BBG increases the mRNA expressions and protein levels of distal-less homeobox 5 and runt-related transcription factor 2. Furthermore BBG also increases p38, Smad1/5/9 phosphorylation and mineralization. We confirmed the regenerative effect of BBG on caudal fin in zebrafish by applying Alizarin Red staining analysis. Taken together, these results indicate that BBG increases osteogenic differentiation via activation of p38 MAPK-mediated Smad1/5/9 in MC3T3-E1 cells and mouse calvaria primary cells.

Keywords: p38 MAPK, Smad1/5/9, barley β-glucan, osteoblast differentiation, MC3T3-E1 cells

서 론

β-Glucan은 포도당(glucose)이 β-(1,3), β-(1,4) 또는 β-(1,6) 결합으로 구성된 다당류로, 보리 및 귀리와 같은 곡류의 세포벽에서 발견되고 조류(algae), 버섯, 균류, 박테리아 같은 다양한 organism에도 함유되어 있다(Volman 등, 2008; Du 등, 2019; Rahar 등, 2011; Schwartz와 Vetvicka, 2021). β-Glucan은 잘 알려진 biologic response modifiers로 감염성 질환 및 암에 대한 면역조절제(immunostimulants) 역할을 담당하고 있으며(Brown과 Gordon, 2003; Yun 등, 2003; Zeković 등, 2005), 인체의 면역반응을 조절하여 항암효과를 가지는 것으로 알려져 있다(Han 등, 2014; Chan 등, 2009). 또한, barley β-glucan은 미국식품의약국(FDA)의 1일 섭취 권장량이 3~5 g으로, 혈중 콜레스테롤 및 중성지방의 수치를 낮추고 혈압을 감소시키는 효과를 나타낸다는 보고가 있다(Karmally 등, 2005; Liu 등, 1999; Vetvicka과 Vetvickova, 2009; Lattimer와 Haub, 2010; Lee 등, 2015).

뼈는 일생 재형성되는 역동적인 조직으로 뼈의 항상성 조절에 중요한 역할을 새로운 뼈를 형성하는 조골세포와 오래된 뼈를 제거해주는 파골세포가 담당하고 있다(Shin과 Cho, 2005; Mori, 2017; Sims 등, 1996; Eriksen, 2010; Chen 등, 2018). 조골세포는 중간엽 줄기세포로부터 분화되고 조골세포 분화는 증식, 세포외 기질의 성숙 및 무기질화 단계를 거치게 되며, 다양한 신호전달경로를 통해 조절된다(Hwang 등, 2009; Minguell 등, 2001; Bermúdez-Reyes 등, 2018). 조골세포 분화는 transforming growth factor β(TGF-β) superfamily의 구성원인 bone morphogenetic protein 2(BMP2)에 의해 자극되어 Smad 신호전달경로를 통해(Suda 등, 1995) 다양한 호르몬 및 distal-less homobox 5(Dlx5), runt-related transcription factor 2(Runx2)와 같은 다양한 전사인자에 의해 조절된다(Ryoo 등, 2006; Heo 등, 2016; Simeone 등, 1994). In vitro에서 Alizarin Red 염색은 extracellular matrix에 calcium apatite가 침착된 mineralization 수준을 확인할 수 있다(Declercq 등, 2005). 조골세포 분화에서 mineralization은 중요한 역할을 담당하고 있다는 보고가 있다(Ahmad 등, 1999; Wu 등, 2021).

Mitogen-activated protein kinase(MAPK)는 증식, 스트레스 반응, 세포 사멸 및 분화와 같은 세포 내 중요한 신호들을 조절하는 것으로 알려져 있다(Cargnello와 Roux, 2011; Zhang과 Liu, 2002; Ai 등, 2016; Sun 등, 2015; Buscà 등, 2016; Cuadrado와 Nebreda, 2010; Liu와 Lin, 2005). MAPK는 extracellular signal-regulated kinase (ERK), c-Jun N-terminal protein kinase(JNK) and p38 MAPK로 구성되어 있다. p38의 활성화는 중간엽 줄기세포에서부터 분화된 근육세포, 지방세포, 연골세포, 조골세포와 같은 다양한 세포의 분화를 유도한다는 보고가 있다(Lai 등, 2001; Liao 등, 2002; Leiva 등, 2020; Takebe 등, 2011). p38은 초기 조골세포 분화에 중요한 역할을 담당하고 있다고 알려져 있다(Greenblatt 등, 2013). p38 인산화는 조골세포 전사인자 유전자를 활성 및 발현을 증가시켜 골 형성 진행을 촉진한다는 보고가 되어있다(Greenblatt 등, 2010). Calvaria organ cultures에서 p38 inhibitor(SB203580)를 처리하여 p38의 억제를 통해 mineralization을 감소시키는 연구가 보고된 바가 있다(Ge 등, 2012).

본 연구는 barley β-glucan이 조골세포 분화에 어떤 영향을 미치는지 확인하였다. 이를 분석하기 위해 조골 전구세포 MC3T3-E1 cells와 mouse calvaria primary cells에 barley β-glucan 처리를 통해 조골세포 분화 유전자 발현과 조골세포 분화 유전자 및 p38, Smad1/5/9의 단백질 수준을 확인하고 칼슘 침착을 통해 조골세포 분화의 분자적 기전을 확인하였다.

재료 및 방법

실험 재료 및 시약

본 실험에 사용된 MC3T3-E1(subclone 4 CRL 2593) 세포는 American Type Culture Collection(Manassas, VA, USA)에서 구입하였다. α-MEM, penicillin streptomycin, calf serum은 Gibco BRL(Grand Island, NY, USA)에서 구입하였고, fetal bovine serum은 Merck(New Jersey, MA, USA)에서, barley β-glucan(G6513; BBG), ascorbic acid, β-glycerophosphate, ponceau, skim milk, Alizarin Red는 Sigma Aldrich(St. Louis, MO, USA)에서 구입하여 사용하였다. TRI-solution은 Bioscience Technology(Gyeongsan, Korea)에서 구입하였고, TOP scriptTM RT Dry MIX는 Enzynomics(Daejeon, Korea)에서, Emerald Amp GT PCR Master Mix는 TaKaRa(Tokyo, Japan)에서 구입하여 사용하였다. RIPA buffer는 ATTO (Tokyo, Japan)에서 구입하여 사용하였고, polyvinylidene fluoride(PVDF) membrane은 Roche(Basel, Switzerland)에서, AmershamTM ECL은 Cytiva(Incheon, Korea)에서 구입하여 사용하였다. p38 inhibitor(SB203580)는 InvivoGen(San Diego, CA, USA)에서, 1차 항체 p-Smad1/5/9, p-p38 and t-p38은 Cell Signaling Technology(Danvers, MA, USA)에서 구입하여 사용하였다. Dlx5는 Abcam(Cambridge, UK)에서, Smad1, Runx2, β-actin과 2차 항체 anti-rabbit IgG, anti-mouse IgG는 Santa Cruz Biotechnology(Dallas, Texas, USA)에서 구입하여 사용하였다.

세포 배양

MC3T3-E1 세포 유지 시에는 α-MEM 배지에 10% calf serum과 1% 항생제(100 U/mL penicillin-100 μg/mL streptomycin)를 첨가하여 37°C, 5% CO2 조건으로 배양하였다. MC3T3-E1 cells를 35 mm dish와 24-well plate에 배양하여 80% 포화하게 되면 5 μM BBG와 5 mM β-glycerophosphate, 50 μg/mL ascorbic acid가 포함된 배지로 2일마다 배지를 교체하면서 분화를 유도하였다.

유전자 발현 분석법(RT-PCR analysis)

조골세포에 BBG(5 μM)를 처리하여 1, 2, 4일 배양하였다. 배양한 세포는 dPBS로 세척하고 TRI-solutionTM을 이용하여 MC3T3-E1 cells에서 총 RNA를 추출 및 분리하였다. cDNA는 제조사의 지시에 따라 TOP scriptTM RT Dry MIX를 사용하여 total RNA로부터 합성되었다. PCR 반응 조건은 95°C에서 10분, 95°C에서 30초, annealing 온도에서 30초, 72°C에서 30초 후 다시 95°C에서 30초 돌아가는 cycle을 반복하고 72°C에서 5분 진행하였다. 중합효소 반응에 사용된 primer 정보는 Table 1에 나타내었다.

Table 1 . Specific primers for RT-PCR.

GeneFoward primerReverse primer
Dlx5GAGAAGAGTCCCAAGCATCCGAGCGCTTTGCCATAAGAAG
Runx2CCGCACGACAACCGCACCATCGCTCCGGCCCACAAATCTC
β-actinTTCTTTGCAGCTCCTTCGTTGCCGTGGATGGCTACGTACATGGCTGGG


단백질 발현 분석법(western blot analysis)

35 mm dish에서 배양한 MC3T3-E1 세포에 BBG를 처리한 샘플을 RIPA buffer를 사용하여 단백질을 회수하였다. 추출한 단백질은 Bradford 방법(Jain, 2017)으로 정량하였다. 동일한 양의 단백질을 sample buffer에 첨가하여 100°C에서 5분 동안 끓인 후, SDS polyacrylamide gel electrophoresis를 수행하였다. 전기영동이 끝난 gel 상의 단백질은 transfer 장치를 이용하여 PVDF membrane에 단백질을 이동시켰다. 단백질이 잘 이동하였는지 확인하기 위하여 ponceau 염색을 하였고, 확인 후 Tris-buffered saline with Tween 20(TBST) buffer로 세척하였다. Membrane을 5% skim milk로 blocking 한 후, 1차 항체를 4°C에서 overnight 하여 반응시켰다. TBST로 10분씩 4번 세척 후 2차 항체를 반응시켰다. 다시 TBST로 10분씩 4번 세척 후, AmershamTM ECL reagent 1과 reagent 2를 1:1로 혼합하여 단백질의 발현을 확인하였다.

골의 석회화 측정(Alizarin Red S 염색)

MC3T3-E1 세포를 24-well plate에 well 당 5×104개로 접종하여 BBG를 처리하여 3주간 배양하였다. 그 후 배지를 제거하고 dPBS로 세척하여 4% formaldehyde로 5분간 실온에서 고정시켰다. 세포의 고정이 끝난 후 2% Alizarin Red solution으로 20분간 염색하고 3차 증류수로 세척 후 Epson Perfection V37 scanner(EPSON, Nagano, Japan)를 통해 이미지화하였다.

실험동물

Mouse calvaria primary cells isolation을 하기 위해 사용된 ICR mouse는 12시간 낮/밤 주기와 20~22°C, 습도 50~60% 조건에서 유지하고 물과 사료는 자유롭게 섭취하도록 하였다(Kim 등, 2020). Zebrafish(Danio rerio) 길이 3.4~4.4 cm zebrafish를 수조(300 mL, 한 수조당 3마리)에서 30±1°C 12시간의 낮/밤 주기를 유지하여 사육했다. Artemia nauplii(Artemia salina)와 Tetra bits complete를 매일 급여했으며 물은 2일마다 교체했다. 골 재생을 확인하기 위해 zebrafish는 3~5초 냉수에서 기절시킨 후, 꼬리지느러미의 아랫부분을 절단했다. 본 실험은 대구대학교 실험동물관리 및 이용위원회(DUIACUC-12020/4-0313-006)의 승인을 받아 진행하였다.

Mouse calvaria primary cells isolation

생후 2일 된 ICR mouse의 두개골을 적출하였다. 적출된 두개골은 HBSS(Cytiva, Seoul, Korea)와 함께 0.1% collagenase D(Roche) 및 0.2% dispase(Gibco)를 20분 incubator에서 반응시켜 상층액을 수집하였다. 이 단계를 5회 반복하였다. 1,800 rpm에서 8분 동안 사용하여 mouse calvaria primary cells를 얻었다.

Zebrafish ARS 염색

BBG(5 μM)에 대한 골 재생을 확인하기 위해 Alizarin Red S 염색을 진행했다. 수조에 있는 zebrafish에 BBG를 처리하여 사육 조건에 맞춰 6일 동안 사육했다. Zebrafish를 고정하기 위해 24시간 동안 10% formaldehyde 용액을 사용해서 고정하였다. Mineralization의 시각화를 증가시키기 위해서 zebrafish를 1% KOH 및 3% hydrogen peroxide로 12시간 동안 침연시켰다. 그 후 zebrafish에 25% sodium tetraborate를 2시간 동안 처리하고, 물로 세척한 뒤 Alizarin Red 염색을 하였다.

통계처리

본 연구에서 얻은 결과는 표준오차로 표시하였고, 통계처리는 GraphPad Prism 5(GraphPad Software Inc., San Diego, CA, USA)에서 Student's t-test를 이용하였으며, P<0.05인 경우 대조군과 BBG 처리군 사이에 유의성이 있음을 인정하였다.

결과 및 고찰

BBG가 조골세포 분화에 미치는 영향

MC3T3-E1은 murine calvaria pre-osteoblast cell line으로 뼈 연구에서 대표적인 세포로 알려져 있다(Hwang과 Horton, 2019; Wang 등, 1999). 이전 연구에서 BBG는 파골세포 분화를 억제한다는 보고가 있다(Ariyoshi 등, 2021). MC3T3-E1 subclone 4 세포는 세포주이며 pre-osteoblast like cells maturation으로 조골세포 기질의 무기질화를 연구하는 데 사용된다. 조골세포 분화 유전자를 발현하고 ascorbic acid에 의해 mineralization 된 세포 외 기질을 형성한다(Franceschi와 Iyer, 1992). Mouse calvaria primary cell은 neonatal mouse의 두개골 조직에서 분리된 세포이며, 조직의 특성을 가지고 있다. 안정적인 표현형이 발현되어 primary cell의 실험 결과가 세포주 실험 결과보다 더 신뢰받는다. 그러나 primary cell은 장기간 배양하게 되면 세포주에 비해 제한된 증식 활동으로 인해 세포의 수가 감소한다(Liu 등, 2019). 본 연구의 MC3T3-E1 세포 및 mouse calvaria primary cells에서 BBG(Fig. 1)의 조골세포 분화 효과를 확인하고자 RT-PCR 분석과 western blot 분석을 통해 BBG의 처리 농도 및 처리 시간에 따른 조골세포 분화 유전자 Dlx5, Runx2의 유전자 발현과 단백질 수준을 분석하였다. BBG 처리 농도에 따른 결과로 MC3T3-E1 세포에서는 Dlx5, Runx2의 유전자 발현이 농도 의존적으로 증가하며(Fig. 2A upper panel), mouse calvaria primary cells(primary cells)에는 Dlx5, Runx2의 유전자 발현이 1 μM에서 높게 발현되었다(Fig. 2A lower panel). 다음으로 MC3T3-E1 세포에서 BBG 농도별 처리에 의한 Dlx5, Runx2의 단백질 수준을 확인하였다. 그 결과로 Dlx5, Runx2의 단백질 발현이 5 μM 농도에서 유의하게 증가하였다(Fig. 2B). 다음은 BBG의 처리 시간에 따른 Dlx5, Runx2 유전자의 발현 수준을 확인하였다. MC3T3-E1 세포에서 Dlx5 발현은 2일 차에, Runx2는 4일 차에 발현이 증가하였으며, primary cells에서는 Dlx5, Runx2의 유전자 발현이 시간 의존적으로 유의하게 증가하는 것으로 나타났다(Fig. 2C). MC3T3-E1 세포에서 Dlx5는 2일 차에, Runx2는 4일 차에 단백질 발현이 증가하였고, primary cells에서 Dlx5는 2일 차, Runx2는 1일 차에 유의하게 증가하는 것으로 나타났다(Fig. 2D). Alizarin Red 염색은 식물성 염료로 무기질화된 세포외 기질에 특이적으로 결합을 한다(Redlich 등, 2002). 이를 통해 세포 외 기질에 침착된 칼슘의 양을 알 수 있다(Maeda 등, 2001; Schiller 등, 2001). BBG 처리를 통해 칼슘 침착이 증가하는 것을 확인할 수 있다(Fig. 2E). 이러한 결과를 통해 BBG가 조골세포 분화를 증가시키는 것으로 판단된다.

Fig 1. Structure of barley β-glucan.

Fig 2. The effect of barley β-glucan (BBG) on osteogenic differentiation of MC3T3-E1 cells and mouse calvaria primary cells. (A) MC3T3-E1 cells and mouse calvaria primary cells were incubated 0.5, 1, and 5 μM BBG for 2 days. (B) MC3T3-E1 cells were incubated 0.5, 1, and 5 μM BBG (5 μM) for 2 days. (C) Cells were treated BBG (5 μM) for 1, 2, and 4 days, after which cells were harvested for total RNA isolation, confirmed by RT-PCR analysis of Dlx5, Runx2, and β-actin mRNA expression. (D) MC3T3-E1 cells and mouse calvaria primary cells were treated BBG (5 μM) for 1, 2, and 4 days. Western blot analysis of Dlx5, Runx2, and β-actin protein levels. (E) MC3T3-E1 cells were treated with BBG (5 μM), 50 μg/mL ascorbic acid (AA), and 5 mM β-glycerophosphate (β-GP) for 2 weeks on calcium deposition. The graph has shown using ImageJ. *P<0.05 and **P<0.01 compared to the untreated control, respectively. Results were presented as mean±SEM (n≥3).

BBG가 p38 인산화에 미치는 효과

p38 MAPK 활성화는 primary calvaria osteoblast cells 및 bone marrow osteoprogenitor cells, stromal cell lines 분화에 중요한 역할이 보고되어 있다(Wang 등, 2007). 본 연구에서는 western blot 분석을 통해 BBG에 의한 p38의 발현을 확인하였다. 그 결과 BBG 처리를 통해 p38의 단백질 발현이 60분까지 시간 의존적으로 증가하였다가 120분부터 감소하는 것으로 나타났다(Fig. 3A). 다음으로 p38 억제제(SB203580)를 처리하여 조골세포 유전자 발현을 확인하기 위해 RT-PCR 분석을 통해 확인하였다. MC3T3-E1 및 primary cells에서 BBG의 단독처리 시 Dlx5, Runx2 유전자 발현이 증가하였으나, BBG와 SB203580을 함께 처리하면 Dlx5, Runx2 유전자 발현이 감소함을 확인하였다(Fig. 3B). 또한, 단백질 발현 분석을 통해 MC3T3-E1 세포에서 BBG 처리로 증가한 p-p38 단백질 발현이 SB203580과 함께 처리한 그룹에서 p-p38이 감소하는 것으로 나타났다(Fig. 3C). BBG 처리에 의한 칼슘 침착을 확인하기 위해 Alizarin Red 염색을 수행하였다. BBG 5 μM의 처리로 칼슘 침착이 유의하게 증가하였고, BBG와 SB203580을 함께 처리했을 때 칼슘 침착이 감소하는 것으로 나타났다(Fig. 3D). 이를 통해 BBG 단독처리가 Dlx5, Runx2와 p38의 단백질 발현과 Dlx5, Runx2 유전자 발현이 증가하였지만, SB203580 처리를 통해 Dlx5, Runx2 유전자의 발현과 Dlx5, Runx2 및 p38의 단백질 발현을 감소시키는 결과를 확인하였다. 본 연구에서 BBG가 p38 신호전달경로를 통해 조골세포 분화를 조절하는 것으로 판단된다.

Fig 3. Effects of p38 inhibition on barley β-glucan (BBG)-induced osteogenic differentiation. (A) MC3T3-E1 cells were treated BBG (5 μM) for 0∼240 min and p-p38, t-p38, and β-actin confirmed by western blot analysis. (B) MC3T3-E1 cells and mouse calvaria primary cells were treated with BBG (5 μM) and SB203580 (20 μM) for 2 days and Dlx5, Runx2, and β-actin mRNA expression confirmed by RT-PCR analysis. (C) MC3T3-E1 cells were treated BBG (5 μM) and SB203580 (20 μM) for 0.5 h and p-p38, t-p38, and β-actin protein levels confirmed by western blot analysis. (D) MC3T3-E1 cells were incubated with BBG (5 μM) and SB203580 (20 μM) for 2 weeks and ARS staining was performed to determine calcium deposition. The graph has shown using ImageJ. *P<0.05 and **P<0.01 compared to the untreated control, #P<0.05 compared to the BBG treated respectively. Results were presented as mean±SEM (n≥3).

BBG가 Smad1/5/9 인산화에 미치는 효과

R-Smad는 receptor regulated Smads이며, 세포 내 신호전달의 mediator로 Smad 단백질은 TGF-β 신호에 의해 자극이 되면 세포질에 있는 Smad는 인산화되어 핵에 축적되어 표적 유전자 발현을 조절하는 역할을 한다(Xu, 2006). BBG 처리에 의한 Smad1/5/9의 단백질 발현을 확인하기 위해 western blot 분석을 진행하였다. 분석을 통해 MC3T3-E1 세포에서 p-Smad1/5/9의 단백질 발현이 30분까지 증가하다가 60분부터 감소하는 것을 확인하였다(Fig. 4A). 그리고 MC3T3-E1과 primary cells에 SB203580 처리 후 Smad1/5/9의 인산화를 확인하였다. 두 세포 모두 BBG 단독처리 그룹에서 Smad1/5/9의 인산화가 증가하고, SB203580을 함께 처리한 그룹에서 감소하는 것을 나타내었다(Fig. 4B). 본 연구에서는 BBG 단독처리로 Smad1/5/9의 인산화가 증가하고 p38 억제제(SB203580) 처리에 의해 Smad1/5/9의 인산화가 감소하는 결과를 나타내었다. 이 결과는 BBG가 p38 신호전달경로를 통해 Smad1/5/9의 인산화를 조절하여 조골세포 분화를 증가시킴을 시사한다.

Fig 4. Barley β-glucan (BBG) increased phosphorylation of Smad1/5/9. (A) MC3T3-E1 cells were treated BBG (5 μM) 0∼240 min, western blot analysis were performed to measure the protein levels of p-Samd1/5/9, t-Smad, and β-actin. (B) MC3T3-E1 cells and mouse calvaria primary cells were treated BBG (5 μM) and SB203580 (20 μM) for 0.5 h and p-Smad1/5/9, t-Samd1, and β-actin protein levels confirmed by western blot analysis. The graph has shown using ImageJ. *P<0.05 compared to the untreated control respectively. Results were presented as mean±SEM (n≥3).

BBG가 성체 zebrafish의 골 재형성에 미치는 영향

Zebrafish 꼬리지느러미는 조골세포 분화에 의해 재생된다는 것을 대변한다(Lim 등, 2021). In vitro 연구 결과에서 BBG가 조골세포 분화 유전자 발현과 단백질 수준을 증가시키는 것을 확인하였다. 그래서 BBG가 골 재생을 증가시키는 효능이 있을 것이라는 가정을 하였다. In vivo 상에서 BBG의 효과를 확인하기 위해 성체 zebrafish에 BBG(5 μM, 50 μM)를 처리하였고 대조군과 비교하였다. 그 결과 BBG를 처리하여 Alizarin Red 염색을 통해 성체 zebrafish의 꼬리지느러미의 골 형성을 확인하였다. 그러나 50 μM BBG 처리그룹보다 5 μM BBG 처리그룹에서 골 형성의 유의적인 증가를 확인하였다(Fig. 5A). 본 연구에서 BBG가 성체 zebrafish의 꼬리지느러미의 골 형성 효과를 보이는 것을 확인하였다. 종합해보면 BBG가 p38 MAPK 신호전달경로의 활성화를 통해 Smad1/5/9가 인산화되어 MC3T3-E1 cells와 mouse calvaria primary cells에서 Dlx5, Runx2 발현을 상향 조절하여 조골세포 분화를 촉진한다(Fig. 5B).

Fig 5. Barley β-glucan (BBG) increased regeneration zebrafish caudal fin rays. (A) Caudal fin rays of adult zebrafish were amputated at 0 day and ARS staining was analyzed. Total caudal-fin rays and the enlarged part are shown at the top and bottom, respectively. Caudal fin rays of adult zebrafish were quantitated and compared between the control group and BBG (5 and 50 μM) group treatment with 7 days. The zebrafish image was taken from the picture gallery site. The graph has shown using ImageJ. **P<0.01 compared to the untreated control. (B) Molecular mechanism of BBG promotes Dlx5 and Runx2 genes via activated p38 MAPK-mediated, Smad1/5/9 in MC3T3-E1 cells and mouse calvaria primary cells.

요 약

본 연구에서는 barley β-glucan(BBG)이 조골세포 분화에 미치는 영향을 조사하였다. 조골 전구세포주인 MC3T3-E1 cells와 mouse calvaria primary cells에서 BBG를 처리하여 실험을 진행하였다. MC3T3-E1 cells 및 mouse calvaria primary cells에서 BBG를 처리하여 RT-PCR 분석법을 통해 Dlx5, Runx2 유전자 발현을 증가시키는 것을 확인하였다. Western blot 분석법을 통해 Dlx5, Runx2와 p-p38, p-Smad1/5/9 단백질 발현이 증가하는 것도 확인하였다. 또한, Alizarin Red 염색으로 BBG 처리에 의해 칼슘 침착이 증가하는 것을 확인하였다. 그뿐만 아니라 BBG에 의해 증가한 Dlx5와 Runx2 유전자 및 단백질 발현과 p-p38, p-Smad 1/5/9의 단백질 발현이 p38 억제제(SB203580) 처리로 감소한 것을 확인하였다. 이를 통해 BBG가 p38 신호전달경로를 통해 조골세포 분화를 증가시키는 것을 확인하였다. Zebrafish에 BBG를 처리한 후 Alizarin Red 염색을 통해 절단된 꼬리지느러미의 재생이 증가한 것을 확인하였다. 본 연구를 종합해보면 BBG가 조골세포 분화를 증가시켜 골 질환 치료제로 사용될 수 있음을 시사한다.

Fig 1.

Fig 1.Structure of barley β-glucan.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 403-411https://doi.org/10.3746/jkfn.2022.51.5.403

Fig 2.

Fig 2.The effect of barley β-glucan (BBG) on osteogenic differentiation of MC3T3-E1 cells and mouse calvaria primary cells. (A) MC3T3-E1 cells and mouse calvaria primary cells were incubated 0.5, 1, and 5 μM BBG for 2 days. (B) MC3T3-E1 cells were incubated 0.5, 1, and 5 μM BBG (5 μM) for 2 days. (C) Cells were treated BBG (5 μM) for 1, 2, and 4 days, after which cells were harvested for total RNA isolation, confirmed by RT-PCR analysis of Dlx5, Runx2, and β-actin mRNA expression. (D) MC3T3-E1 cells and mouse calvaria primary cells were treated BBG (5 μM) for 1, 2, and 4 days. Western blot analysis of Dlx5, Runx2, and β-actin protein levels. (E) MC3T3-E1 cells were treated with BBG (5 μM), 50 μg/mL ascorbic acid (AA), and 5 mM β-glycerophosphate (β-GP) for 2 weeks on calcium deposition. The graph has shown using ImageJ. *P<0.05 and **P<0.01 compared to the untreated control, respectively. Results were presented as mean±SEM (n≥3).
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 403-411https://doi.org/10.3746/jkfn.2022.51.5.403

Fig 3.

Fig 3.Effects of p38 inhibition on barley β-glucan (BBG)-induced osteogenic differentiation. (A) MC3T3-E1 cells were treated BBG (5 μM) for 0∼240 min and p-p38, t-p38, and β-actin confirmed by western blot analysis. (B) MC3T3-E1 cells and mouse calvaria primary cells were treated with BBG (5 μM) and SB203580 (20 μM) for 2 days and Dlx5, Runx2, and β-actin mRNA expression confirmed by RT-PCR analysis. (C) MC3T3-E1 cells were treated BBG (5 μM) and SB203580 (20 μM) for 0.5 h and p-p38, t-p38, and β-actin protein levels confirmed by western blot analysis. (D) MC3T3-E1 cells were incubated with BBG (5 μM) and SB203580 (20 μM) for 2 weeks and ARS staining was performed to determine calcium deposition. The graph has shown using ImageJ. *P<0.05 and **P<0.01 compared to the untreated control, #P<0.05 compared to the BBG treated respectively. Results were presented as mean±SEM (n≥3).
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 403-411https://doi.org/10.3746/jkfn.2022.51.5.403

Fig 4.

Fig 4.Barley β-glucan (BBG) increased phosphorylation of Smad1/5/9. (A) MC3T3-E1 cells were treated BBG (5 μM) 0∼240 min, western blot analysis were performed to measure the protein levels of p-Samd1/5/9, t-Smad, and β-actin. (B) MC3T3-E1 cells and mouse calvaria primary cells were treated BBG (5 μM) and SB203580 (20 μM) for 0.5 h and p-Smad1/5/9, t-Samd1, and β-actin protein levels confirmed by western blot analysis. The graph has shown using ImageJ. *P<0.05 compared to the untreated control respectively. Results were presented as mean±SEM (n≥3).
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 403-411https://doi.org/10.3746/jkfn.2022.51.5.403

Fig 5.

Fig 5.Barley β-glucan (BBG) increased regeneration zebrafish caudal fin rays. (A) Caudal fin rays of adult zebrafish were amputated at 0 day and ARS staining was analyzed. Total caudal-fin rays and the enlarged part are shown at the top and bottom, respectively. Caudal fin rays of adult zebrafish were quantitated and compared between the control group and BBG (5 and 50 μM) group treatment with 7 days. The zebrafish image was taken from the picture gallery site. The graph has shown using ImageJ. **P<0.01 compared to the untreated control. (B) Molecular mechanism of BBG promotes Dlx5 and Runx2 genes via activated p38 MAPK-mediated, Smad1/5/9 in MC3T3-E1 cells and mouse calvaria primary cells.
Journal of the Korean Society of Food Science and Nutrition 2022; 51: 403-411https://doi.org/10.3746/jkfn.2022.51.5.403

Table 1 . Specific primers for RT-PCR.

GeneFoward primerReverse primer
Dlx5GAGAAGAGTCCCAAGCATCCGAGCGCTTTGCCATAAGAAG
Runx2CCGCACGACAACCGCACCATCGCTCCGGCCCACAAATCTC
β-actinTTCTTTGCAGCTCCTTCGTTGCCGTGGATGGCTACGTACATGGCTGGG

References

  1. Ahmad M, McCarthy M, Gronowicz G. An in vitro model for mineralization of human osteoblast-like cells on implant materials. Biomaterials. 1999. 20:211-220.
    CrossRef
  2. Ai X, Yan J, Carrillo E, Ding W. The stress-response MAP kinase signaling in cardiac arrhythmias. Rev Physiol Biochem Pharmacol. 2016. 172:77-100.
    Pubmed KoreaMed CrossRef
  3. Ariyoshi W, Hara S, Koga A, Nagai-Yoshioka Y, Yamasaki R. Biological effects of β-glucans on osteoclastogenesis. Molecules. 2021. 26:1982. https://doi.org/10.3390/molecules26071982
    Pubmed KoreaMed CrossRef
  4. Bermúdez-Reyes B, Lara-Banda MR, Reyes-Zarate E, Rojas-Martínez A, Camacho A, Moncada-Saucedo N, et al. Effect on growth and osteoblast mineralization of hydroxyapatite-zirconia (HA-ZrO2) obtained by a new low temperature system. Biomed Mater. 2018. 13:035001. https://doi.org/10.1088/1748-605X/aaa3a4
    Pubmed CrossRef
  5. Brown GD, Gordon S. Fungal β-glucans and mammalian immunity. Immunity. 2003. 19:311-315.
    CrossRef
  6. Buscà R, Pouysségur J, Lenormand P. ERK1 and ERK2 map kinases: Specific roles or functional redundancy?. Front Cell Dev Biol. 2016. 4:53. https://doi.org/10.3389/fcell.2016.00053
    Pubmed KoreaMed CrossRef
  7. Cargnello M, Roux PP. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol Mol Biol Rev. 2011. 75:50-83.
    Pubmed KoreaMed CrossRef
  8. Chan GCF, Chan WK, Sze DMY. The effects of β-glucan on human immune and cancer cells. J Hematol Oncol. 2009. 2:25. https://doi.org/10.1186/1756-8722-2-25
    Pubmed KoreaMed CrossRef
  9. Chen X, Wang Z, Duan N, Zhu G, Schwarz EM, Xie C. Osteoblast-osteoclast interactions. Connect Tissue Res. 2018. 59:99-107.
    Pubmed KoreaMed CrossRef
  10. Cuadrado A, Nebreda AR. Mechanisms and functions of p38 MAPK signalling. Biochem J. 2010. 429:403-417.
    Pubmed CrossRef
  11. Declercq HA, Verbeeck RMH, De Ridder LIFJM, Schacht EH, Cornelissen MJ. Calcification as an indicator of osteoinductive capacity of biomaterials in osteoblastic cell cultures. Biomaterials. 2005. 26:4964-4974.
    Pubmed CrossRef
  12. Du B, Meenu M, Liu H, Xu B. A concise review on the molecular structure and function relationship of β-glucan. Int J Mol Sci. 2019. 20:4032. https://doi.org/10.3390/ijms20164032
    Pubmed KoreaMed CrossRef
  13. Eriksen EF. Cellular mechanisms of bone remodeling. Rev Endocr Metab Disord. 2010. 11:219-227.
    Pubmed KoreaMed CrossRef
  14. Franceschi RT, Iyer BS. Relationship between collagen synthesis and expression of the osteoblast phenotype in MC3T3-E1 cells. J Bone Miner Res. 1992. 7:235-246.
    Pubmed CrossRef
  15. Ge C, Yang Q, Zhao G, Yu H, Kirkwood KL, Franceschi RT. Interactions between extracellular signal-regulated kinase 1/2 and p38 MAP kinase pathways in the control of RUNX2 phosphorylation and transcriptional activity. J Bone Miner Res. 2012. 27:538-551.
    Pubmed KoreaMed CrossRef
  16. Greenblatt MB, Shim JH, Glimcher LH. Mitogen-activated protein kinase pathways in osteoblasts. Annu Rev Cell Dev Biol. 2013. 29:63-79.
    Pubmed CrossRef
  17. Greenblatt MB, Shim JH, Zou W, Sitara D, Schweitzer M, Hu D, et al. The p38 MAPK pathway is essential for skeletogenesis and bone homeostasis in mice. J Clin Invest. 2010. 120:2457-2473.
    Pubmed KoreaMed CrossRef
  18. Han MD, Kim YH, Kim WJ. In vivo growth inhibition of sarcoma-180 cells by a β-glucan from the mushroom Ganoderma lucidum. J Life Sci. 2014. 24:721-727.
    CrossRef
  19. Heo JS, Choi Y, Kim HS, Kim HO. Comparison of molecular profiles of human mesenchymal stem cells derived from bone marrow, umbilical cord blood, placenta and adipose tissue. Int J Mol Med. 2016. 37:115-125.
    Pubmed KoreaMed CrossRef
  20. Hwang NS, Zhang C, Hwang YS, Varghese S. Mesenchymal stem cell differentiation and roles in regenerative medicine. Wiley Interdiscip Rev Syst Biol Med. 2009. 1:97-106.
    Pubmed CrossRef
  21. Hwang PW, Horton JA. Variable osteogenic performance of MC3T3-E1 subclones impacts their utility as models of osteoblast biology. Sci Rep. 2019. 9:8299. https://doi.org/10.1038/s41598-019-44575-8
    Pubmed KoreaMed CrossRef
  22. Jain A. Protein measurement using Bradford assay and photopette®. Tip Biosystems. 2017. p 1-3.
  23. Karmally W, Montez MG, Palmas W, Martinez W, Branstetter A, Ramakrishnan R, et al. Cholesterol-lowering benefits of oat-containing cereal in Hispanic Americans. J Am Diet Assoc. 2005. 105:967-970.
    Pubmed CrossRef
  24. Kim KM, Son HE, Min HY, Jang WG. Vitexin enhances osteoblast differentiation through phosphorylation of Smad and expression of Runx2 at in vitro and ex vivo. Mol Biol Rep. 2020. 47:8809-8817.
    Pubmed CrossRef
  25. Lai CF, Chaudhary L, Fausto A, Halstead LR, Ory DS, Avioli LV, et al. Erk is essential for growth, differentiation, integrin expression, and cell function in human osteoblastic cells. J Biol Chem. 2001. 276:14443-14450.
    Pubmed CrossRef
  26. Lattimer JM, Haub MD. Effects of dietary fiber and its components on metabolic health. Nutrients. 2010. 2:1266-1289.
    Pubmed KoreaMed CrossRef
  27. Lee SH, Jang GY, Hwang IG, Kim HY, Woo KS, Kim KJ, et al. Physicochemical properties of β-glucan from acid hydrolyzed barley. Prev Nutr Food Sci. 2015. 20:110-118.
    Pubmed KoreaMed CrossRef
  28. Leiva M, Matesanz N, Pulgarín-Alfaro M, Nikolic I, Sabio G. Uncovering the role of p38 family members in adipose tissue physiology. Front Endocrinol. 2020. 11:572089. https://doi.org/10.3389/fendo.2020.572089
    Pubmed KoreaMed CrossRef
  29. Liao P, Wang SQ, Wang S, Zheng M, Zheng M, Zhang SJ, et al. p38 mitogen-activated protein kinase mediates a negative inotropic effect in cardiac myocytes. Circ Res. 2002. 90:190-196.
    Pubmed KoreaMed CrossRef
  30. Lim YJ, Kim KM, Jang WG. Chrysophanol increases osteoblast differentiation via AMPK/Smad1/5/9 phosphorylation in vitro and in vivo. Clin Exp Pharmacol Physiol. 2021. 48:515-523.
    Pubmed CrossRef
  31. Liu B, Lu Y, Wang Y, Ge L, Zhai N, Han J. A protocol for isolation and identification and comparative characterization of primary osteoblasts from mouse and rat calvaria. Cell Tissue Bank. 2019. 20:173-182.
    Pubmed KoreaMed CrossRef
  32. Liu J, Lin A. Role of JNK activation in apoptosis: A double-edged sword. Cell Res. 2005. 15:36-42.
    Pubmed CrossRef
  33. Liu S, Stampfer MJ, Hu FB, Giovannucci E, Rimm E, Manson JE, et al. Whole-grain consumption and risk of coronary heart disease: results from the nurses’ health study. Am J Clin Nutr. 1999. 70:412-419.
    Pubmed CrossRef
  34. Maeda T, Matsunuma A, Kawane T, Horiuchi N. Simvastatin promotes osteoblast differentiation and mineralization in MC 3T3-E1 cells. Biochem Biophys Res Commun. 2001. 280:874-877.
    Pubmed CrossRef
  35. Minguell JJ, Erices A, Conget P. Mesenchymal stem cells. Exp Biol Med. 2001. 226:507-520.
    Pubmed CrossRef
  36. Mori S. Aging and homeostasis. Aging of bone. Clin Calcium. 2017. 27:917-923.
  37. Rahar S, Swami G, Nagpal N, Nagpal MA, Singh GS. Preparation, characterization, and biological properties of β-glucans. J Adv Pharm Technol Res. 2011. 2:94-103.
    Pubmed KoreaMed CrossRef
  38. Redlich K, Hayer S, Ricci R, David JP, Tohidast-Akrad M, Kollias G, et al. Osteoclasts are essential for TNF-α-mediated joint destruction. J Clin Invest. 2002. 110:1419-1427.
    Pubmed KoreaMed CrossRef
  39. Ryoo HM, Lee MH, Kim YJ. Critical molecular switches involved in BMP-2-induced osteogenicdifferentiation of mesenchymal cells. Gene. 2006. 366:51-57.
    Pubmed CrossRef
  40. Schiller PC, D’ippolito G, Balkan W, Roos BA, Howard GA. Gap-junctional communication is required for the maturation process of osteoblastic cells in culture. Bone. 2001. 28:362-369.
    CrossRef
  41. Schwartz B, Vetvicka V. Review: β-glucans as effective antibiotic alternatives in poultry. Molecules. 2021. 26:3560. https://doi.org/10.3390/molecules26123560
    Pubmed KoreaMed CrossRef
  42. Shin CS, Cho HY. Bone remodeling and mineralization. J Korean Soc Endocrinol. 2005. 20:543-555.
    CrossRef
  43. Simeone A, Acampora D, Pannese M, D’Esposito M, Stornaiuolo A, Gulisano M, et al. Cloning and characterization of two members of the vertebrate Dlx gene family. Proc Natl Acad Sci U S A. 1994. 91:2250-2254.
    Pubmed KoreaMed CrossRef
  44. Sims NA, Morris HA, Moore RJ, Durbridge TC. Increased bone resorption precedes increased bone formation in the ovariectomized rat. Calcif Tissue Int. 1996. 59:121-127.
    Pubmed CrossRef
  45. Suda T, Udagawa N, Nakamura I, Miyaura C, Takahashi N. Modulation of osteoclast differentiation by local factors. Bone. 1995. 17:S87-S91.
    CrossRef
  46. Sun Y, Liu WZ, Liu T, Feng X, Yang N, Zhou HF. Signaling pathway of MAPK/ERK in cell proliferation, differentiation, migration, senescence and apoptosis. J Recept Signal Transduction. 2015. 35:600-604.
    Pubmed CrossRef
  47. Takebe K, Nishiyama T, Hayashi S, Hashimoto S, Fujishiro T, Kanzaki N, et al. Regulation of p38 MAPK phosphorylation inhibits chondrocyte apoptosis in response to heat stress or mechanical stress. Int J Mol Med. 2011. 27:329-335.
    Pubmed CrossRef
  48. Vetvicka V, Vetvickova J. Effects of yeast-derived β-glucans on blood cholesterol and macrophage functionality. J Immunotoxicol. 2009. 6:30-35.
    Pubmed CrossRef
  49. Volman JJ, Ramakers JD, Plat J. Dietary modulation of immune function by β-glucans. Physiol Behav. 2008. 94:276-284.
    Pubmed CrossRef
  50. Wang D, Christensen K, Chawla K, Xiao G, Krebsbach PH, Franceschi RT. Isolation and characterization of MC3T3-E1 preosteoblast subclones with distinct in vitro and in vivo differentiation/mineralization potential. J Bone Miner Res. 1999. 14:893-903.
    Pubmed CrossRef
  51. Wang X, Goh CH, Li B. p38 mitogen-activated protein kinase regulates osteoblast differentiation through osterix. Endocrinology. 2007. 148:1629-1637.
    Pubmed CrossRef
  52. Wu X, Dai H, Yu S, Zhao Y, Long Y, Li W, et al. Citrate regulates extracellular matrix mineralization during osteoblast differentiation in vitro. J Inorg Biochem. 2021. 214:111269. https://doi.org/10.1016/j.jinorgbio.2020.111269
    Pubmed CrossRef
  53. Xu L. Regulation of Smad activities. Biochim Biophys Acta, Gene Struct Expression. 2006. 1759:503-513.
    Pubmed KoreaMed CrossRef
  54. Yun CH, Estrada A, Van Kessel A, Park BC, Laarveld B. β-Glucan, extracted from oat, enhances disease resistance against bacterial and parasitic infections. FEMS Immunol Med Microbiol. 2003. 35:67-75.
    CrossRef
  55. Zeković DB, Kwiatkowski S, Vrvić MM, Jakovljević D, Moran CA. Natural and modified (1→3)-β-D-glucans in health promotion and disease alleviation. Crit Rev Biotechnol. 2005. 25:205-230.
    Pubmed CrossRef
  56. Zhang W, Liu HT. MAPK signal pathways in the regulation of cell proliferation in mammalian cells. Cell Res. 2002. 12:9-18.
    Pubmed CrossRef