검색
검색 팝업 닫기

Ex) Article Title, Author, Keywords

JKFN Journal of the Korean Society of Food Science and Nutrition



Online ISSN 2288-5978

Article

home All Articles View

Article

Split Viewer

Journal of the Korean Society of Food Science and Nutrition 2021; 50(3): 226-235

Published online March 31, 2021 https://doi.org/10.3746/jkfn.2021.50.3.226

Copyright © The Korean Society of Food Science and Nutrition.

Ginsenoside Conversion and Anti-Inflammatory Effect on RAW 264.7 Cells of Ginseng Extract Vinegar

Kyung Eun Moon1 , Hyeon Hwa Oh1, Do Youn Jeong2, and Young-Soo Kim1

1Department of Food Science and Technology, Jeonbuk National University
2Microbial Institute for Fermentation Industry (MIFI)

Correspondence to:Young-Soo Kim, Department of Food Science and Technology, Jeonbuk National University, 567, Baekjedaero, Deokjin-gu, Jeonju-si, Jeonbuk 54896, Korea, E-mail: ykim@jbnu.ac.kr
Author information: Kyung Eun Moon (Graduate student), Hyeon Hwa Oh (Researcher), Young-Soo Kim (Professor)

Received: December 4, 2020; Revised: January 6, 2021; Accepted: January 7, 2021

Ginseng liqueur (GL) was prepared by adding 9% alcohol to 2% ginseng extract, and was fermented using the selected Acetobacter pasteurianus JBA190503 strain. To another GL, 10% of the seed culture was added and incubated in a shaking incubator at 30°C and 120 rpm for 25 days. The ginsenoside contents of Rg3 and Rg5 in the ginseng extract vinegar (GV) were 55.58 μg/mL and 28.52 μg/mL, respectively, which were more than four times that of GL. The changes in the ginsenoside contents and physicochemical properties (soluble sugar content, pH, total acidity, and organic acid) of the ginseng extract were evaluated during the acetic acid fermentation period. On the 10th day of fermentation, the total acidity increased to 4.10% and reached 6.41% on the 25th day. Acetic acid was identified as a major organic acid and its content was increased to 6,253.01 mg% on the 25th day from 246.05 mg% on the starting day. The anti-inflammatory effect on lipopolysaccharide (LPS, 1 μg/mL)-induced inflammatory reactions in RAW 264.7 cells demonstrated that treatment with GV decreased NO, PGE2, TNF-α and IL-1β production in RAW 264.7 cells by 77.37%, 21.94%, 69.17%, and 91.76%, respectively, and GV inhibited the activation of iNOS and COX-2 gene expression by 61.23% and 20.59%, respectively, at a 1:50 dilution. Based on these findings, the A. pasteurianus JBA190503 strain could be a suitable strain for the industrial fermentation of ginseng in ginseng vinegar production with an enhanced anti-inflammatory effect by increasing the production of low molecular ginsenosides and acetic acid.

Keywords: ginseng liqueur, ginseng extract vinegar, ginsenoside, anti-inflammatory

인삼(Panax ginseng C.A. Meyer)의 주요 유효성분인 진세노사이드(G)는 지금까지 약 40여 종 이상의 구조가 분리 동정되었고(Cheng 등, 2008), 이들 진세노사이드 가운데 G-Rg3는 G-Rg1과 G-Rb1에 이어 가장 많이 연구된 성분으로 항암효과, 항산화 활성, 신경보호, 혈관이완, 항당뇨 및 면역 조절 등의 다양한 약리효과가 알려져 있다(Kim 등, 2017b; Nam 등, 2013). 그러나 G-Rg3는 인삼 천연상태에는 거의 존재하지 않으며 G-Rb1 등과 같은 protopanaxadiol(PPD)계 사포닌의 성분 변환에 의해 생성되는 것으로 보고된다(Park, 1996). 고분자 G-Rb1에서 C-20 위치 gly-cosyl moiety가 제거되어 G-Rg3(S, R)로 전환되며, G-Rg3는 탈수반응을 통해 G-Rg5 및 G-Rk1 등으로 전환된다(Nam 등, 2015). G-Rb1의 구조보다 생리활성이 높은 것으로 알려진 G-Rg3로의 전환량 증가를 위해 고온・고압 및 증숙 가공 또는 미생물을 이용한 발효나 유기산 처리 등이 보고되었다(Nam 등, 2013). 그러나 고온 및 증숙 가공법은 고에너지 요구 및 증숙 과정 중 생성되는 것으로 알려진 벤조피렌 등의 발암물질에 대한 문제점을 가지고 있다(Choi 등, 2012). 미생물을 이용하는 경우에는 식품에 적용 가능하여야 하고 효소적 처리보다 전환율이 상대적으로 낮은 어려움이 있으며, 효소처리의 경우에는 고비용의 정제효소를 사용해야 하는 어려움 때문에 식품산업 적용에 비효율적이다(Ko 등, 2007). 한편, 유기산 처리에 의한 G-Rg3 전환에 대한 연구는 산가수분해 후 생성된 G-Rg3가 산성 상태의 노출에 의해 G-Rg5, -Rk1 등으로 전환되는 경향을 시사하였다(Nam 등, 2013).

초산을 주성분으로 하는 식초는 체지방 감소, 피로회복, 성인병 예방 등의 효과와 더불어 식초 원료에 따른 다양한 유리당, 유기산, 에스터 및 기능성 물질이 함유되어 있다(Sung 등, 2014). 특히 식초의 기능성이 강조되면서 천연발효 식초를 중심으로 단순한 조미 용도에서 기능성 소재 및 건강식품으로도 이용되고 있으며, 이에 따라 고품질의 발효 식초 소비가 증가하고 있다(Kim과 Shin, 2019). 천연발효 식초에 대한 관심이 증가함에 따라 안전하고 균일한 품질의 발효 식초를 생산하는 것이 중요하며, 이를 위해서는 GRAS (generally regarded as safe) 초산균을 사용해야 하지만 현재 식품 원료로 사용될 수 있는 초산균은 Acetobacter pasteurianusAcetobacter aceti 2종이다(MFDS, 2017).

염증반응은 면역세포가 물리적 또는 화학적 자극이나 세균감염을 인지한 후 다양한 염증매개 물질을 분비하여 손상된 부위를 정상상태로 되돌리려는 생체의 방어기전이다(Kim 등, 2017a). 특히 신체에서 동맥경화, 당뇨병, 관절염 및 암과 같은 다양한 질병의 원인인 만성 염증으로 지속적인 염증반응이 일어나게 되어 점막손상이 촉진된다(Ryu 등, 2017). 염증반응과 관련된 유전인자, cytokine 및 염증매개 인자들은 대식세포에 lipopolysaccharides(LPS) 등을 인위적으로 처리하면 유발될 수 있고, 항염증 효과를 가진 물질들은 이와 관련된 반응 산물들의 생성량을 감소시킨다(Kim과 Kim, 2015). G-Rg3, -Rg5, -Rk1 등의 저분자 진세노사이드는 G-Rb1의 경우보다 더 효과적으로 염증반응을 억제시키는것으로 보고되었다(Lee, 2014).

재료 및 시약

인삼주 및 인삼식초 제조를 위해 인삼농축액(Ilhwa Co., Ltd., Jinan, Korea), 순창샘물(Lotus Co., Ltd., Sunchang, Korea), 주정(95.6%, Ethanol Korea Co., Ltd., Seongnam, Korea) 등을 사용하였다. 미생물의 배양을 위한 배지는 BD 사(Franklin Lakes, NJ, USA)에서 구입하여 사용하였다. 세포배양을 위한 Dulbecco’s modified Eagle’s medium(DMEM), bovine calf serum(BCS), fetal bovine serum(FBS), antibiotics(penicillin/streptomycin), Dulbecco’s phosphate-buffered saline(DPBS)은 Gibco BRL(Grand Island, NY, USA) 제품을 사용하였으며, 세포독성 측정을 위하여 cell counting kit-8(CCK-8, Dojindo Molecular Technologies Inc., Rockville, MD, USA) 제품을 사용하였다. 염증유발 및 확인을 위해 lipopolysaccharides from Escherichia coli(LPS, Sigma-Aldrich Co., St. Louis, MO, USA), NaNO2(Alfa Aesar Co., Haverhill, MA, USA), Griess reagent(Sigma-Aldrich Co.), 세포배양액 내의 tumor necrosis factor-α(TNF-α), interleukin-1β(IL-1β), prostaglandin E2(PGE2) 함량은 R&D System사(Minneapolis, MN, USA)의 ELISA kit을 구입하여 측정하였다. Total RNA 추출을 위해 Qiagen RNeasy mini kit(QIAGEN, Hilden, Germany), cDNA 합성을 위해 Go ScriptTM Reverse Transcription system(Promega, Madison, WI, USA) 제품을 사용하였다. 그 밖의 시약들은 HPLC grade를 사용하였다.

인삼농축액 발효식초 제조

시판식초로부터 분리 선발된 A. pasteurianus JBA190503은 GYE 평판배지(1% yeast extract, 5% glucose, 6% ethanol, 2.5% agar)에 도말하고 정치배양기(HB-101M, Hanbaek Scientific Co., Ltd., Bucheon, Korea)에서 활성화(30°C, 3일)시켜 단일 콜로니를 취해 YEg2 액체배지(1% yeast extract, 6% 에탄올, 2% 인삼농축액)에 1 백금이 접종한 후 진탕배양(30°C, 3일, 120 rpm)하여 종초를 제조하였다. 인삼농축액 발효식초 제조를 위한 인삼주(1% yeast extract, 9% 에탄올, 2% 인삼농축액)는 YEg2 액체배지 조성에서 에탄올의 첨가농도를 6%에서 9%로 상향 조정하여 제조하였다. 제조된 인삼주에 종초를 10%(v/v) 첨가하고 진탕배양기(SI-2S, Universal Scientific Industrial Co., Ltd., Shanghai, China)에서 배양(30°C, 120 rpm)하면서 발효 0일차부터 발효 25일차까지 5일 간격으로 샘플링하여 총 산도 증가 여부로 초산발효를 확인하였다. 세포실험을 위한 대조구(control)는 발효 0일차(1% yeast extract, 9% 에탄올, 2% 인삼농축액, 10% 종초)의 조성에서 에탄올 대신 동량의 물을 첨가하여 제조하였고, 제조 즉시 -20°C에 보관하여 차후 실험에 사용하였다.

진세노사이드 함량 측정

인삼농축액 발효식초의 발효기간 중 진세노사이드 함량은 HPLC system(Waters e2695, Waters, Milford, MA, USA)을 사용하여 분석하였으며, 사용된 시료는 0.22 μm membrane filter(Futecs Co., Ltd., Daejeon, Korea)로 여과하여 사용하였다. 진세노사이드 표준물질 mixture는 진안홍삼연구소(Jinan, Korea)로부터 공급받아 정성분석에 사용하였고, G-Rg1(98.4%), G-Rb1(97%), G-Rg3(94.3%), G-Rg5(85%)의 전환을 확인하기 위해 ChromaDex(Los Angeles, CA, USA)로부터 구입하여 정량분석에 사용하였다.

HPLC system에서 사용된 컬럼은 Kinetex의 C18(50×4.6 mm, ID 2.6 μm, Torrance, CA, USA)이었다. 컬럼의 온도는 35°C, 유속은 1.6 mL/min, 시료 주입량은 10 μL였으며, 이동상으로 용매 A는 acetonitrile, 용매 B는 water를 선정하였다. 시간에 따른 용매 조건은 A를 기준으로 나타내었으며, 0~10 min: 18%, 10~40 min: 20%, 40~45 min: 30%, 45~60 min: 37%, 60~65 min: 64%, 65~70 min: 95%로 증가시키고, 75 min까지는 95%로 유지한 후 75~90 min은 18%로 감소시키도록 설정하였다. 검출기는 pho-todiode array detecter(Waters 996, Waters)를 사용하였으며 203 nm에서 검출하였다. 분리된 진세노사이드의 각 peak는 동일 조건에서 분석한 표준물질 mixture의 peak 면적비와 retention time을 비교하여 함량을 산출하였다.

이화학적 특성, 유기산 및 에탄올 함량

인삼식초 발효기간 중 이화학적 특성 변화는 pH, 수용성 고형분 함량 및 총 산도를 측정하여 비교하였다. pH는 pH meter(PP-20, Sartorius, Göttingen, Germany)를 사용하여 측정하였고, 수용성 고형분 함량은 당도계(PAL-1, ATAGO Co., Tokyo, Japan)를 사용하여 측정한 후 °Brix 단위로 표기하였다. 총 산도는 시료에 0.1 N NaOH를 첨가하여 pH 8.3에 도달할 때까지 소모된 NaOH 적정양(mL)을 acetic acid의 환산계수를 곱하여 백분율(%)로 산출하였다.

인삼식초 발효기간 중 유기산 및 잔류 에탄올의 변화는 Kim과 Song(2002)의 방법을 사용하여 측정하였다. 시료를 희석하여 0.22 μm membrane filter로 여과하여 HPLC system(Shimadzu Co., Kyoto, Japan)으로 분석하였다. HPLC system에서 사용된 컬럼은 Aminex HPX87H ion exclusion column(300×7.8 mm, 9 μm, Bio-Rad Labs., Richmond, CA, USA)이었다. 분석조건은 이동상 0.008 M H2SO4, 유속 0.6 mL/min, 컬럼 온도는 35°C였다. 유기산은 UV-VIS detector(SPD-10A, Shimadzu Co.)를 사용하여 210 nm 파장에서 검출하였고, 에탄올은 RID detecter(RID-10A, Shimadzu Co.)를 사용하여 분석하였다. 유기산 정량을 위한 표준물질 citric acid, succinic acid, pyroglutamic acid, acetic acid는 Sigma-Aldrich Co.로부터 구입하여 사용하였으며, 분리된 유기산 및 에탄올의 각 peak는 동일 조건에서 분석한 표준물질 mixture의 peak 면적비와 retention time을 비교하여 함량을 산출하였다.

세포배양 및 세포생존율 측정

항염증 실험을 위한 세포주는 마우스 유래 대식세포인 RAW 264.7 세포(KCLB No. 40071; Korea Cell Line Bank, Seoul, Korea)를 분양받아 사용하였다. 세포배양액은 10% FBS, 1% penicillin/streptomycin을 함유한 DMEM 배지로 하여 5% CO2 incubator(MCO-18AC, Panasonic Healthcare Co., Ltd., Osaka, Japan)에서 37°C 항온을 유지하면서 배양하였다. 계대배양 후 RAW 264.7 세포는 96-well plate에 5×103 cells/well의 밀도로 분주하여 5% CO2 in-cubator에서 37°C 항온을 유지하면서 24시간 배양하였다. 인삼농축액 발효식초와 대조구를 시료로 하여 원액을 40~100배까지 희석하여 희석배수별로 처리하고 48시간 배양하였다. 배양 48시간 후 배지를 제거하고 PBS 100 µL와 CCK-8 solution 10 µL를 첨가하여 암실의 5% CO2 in-cubator에서 2시간 반응하였다. 반응 후 microplate reader(US/Eon, BioTek Instruments, Inc., Winooski, VT, USA)를 사용하여 450 nm에서 흡광도를 측정하였다. 세포생존율은 시료 비첨가구의 흡광도 값에 대한 각 시료 첨가구의 흡광도 값을 백분율로 계산하여 나타내었다.

NO 생성량 및 PGE2 정량

96-well plate에 세포를 5×104 cells/well의 밀도로 분주하여 5% CO2로 조정된 37°C incubator에서 24시간 배양한 후 LPS(1 μg/mL)와 희석배수별로 희석된 시료를 동시에 처리하여 24시간 배양하였다. 배양 후 배양 상등액을 일정량 수거하여 NO 및 PGE2 분석에 이용하였다. NO 생성량 측정은 Kim 등(1999)의 방법을 변형해 진행하였고, Griess reagent와 세포배양액의 반응 후 540 nm에서 흡광도를 측정하여 nitrite 표준용액의 정량곡선을 기준으로 NO 생성량을 산출하였다. PGE2는 PGE2 ELISA kit을 이용하여 제조사의 지시에 따라 측정하였다.

세포배양액의 TNF-α 및 IL-1β정량

96-well plate에 세포를 5×104 cells/well의 밀도로 분주하여 5% CO2로 조정된 37°C incubator에서 24시간 배양한 후 LPS(1 μg/mL)와 희석배수별로 희석된 시료를 동시에 처리하여 24시간 배양하였다. 세포배양 상등액 내의 TNF-α와 IL-1β의 분비량은 ELISA kit을 이용하여 제조사의 지시에 따라 측정하였다.

iNOS 및 COX-2 mRNA 발현 비교

12-well plate에 세포를 5×105 cells/well의 밀도로 분주하여 5% CO2로 조정된 37°C incubator에서 24시간 배양한 후 LPS(1 μg/mL)와 희석배수별로 희석된 시료를 동시에 처리하여 24시간 배양하였다. 배양 후 PBS로 2회 세척하여 Qiagen RNeasy mini kit으로 total RNA를 추출하였다. Total RNA는 GoStriptTM Reverse Transcription system을 이용하여 cDNA로 합성하였고, 합성된 cDNA는 micro-plate reader를 이용하여 정량한 후 이를 template로 사용하여 polymerase chain reaction(PCR)을 진행하였다. PCR 결과물은 1.5% agarose gel을 이용하여 전기영동하고, chemidoc system(c600, Azure Biosystems Inc., Dublin, CA, USA)을 사용하여 밴드를 확인하였다. Image J gel analysis software(NIH, Bethesda, MD, USA)를 이용하여 glyceraldehydes-3-phosphate dehydrogenase(GAPDH)에 대한 iNOS 및 COX-2 발현량을 분석하였다. 실험에 사용한 primer 염기서열은 Table 1과 같다. PCR 조건은 초기 변성(95°C, 2분), denaturation(95°C, 30초), annealing (56°C, 30초), polymerization(72°C, 1분) 순서로 하여 30 cycle을 진행하였고, 72°C에서 10분간 처리하여 종결하였다.

Table 1 . The primer sequence used in the experiment

Target geneGene full nameDirectionPrimer sequence (5′→3′)
iNOSInducible nitric oxide synthaseForwardATGTCCGAAGCAAACATCAC
ReverseTAATGTCCAGGAAGTAGGTG
COX-2Cyclooxygenase-2ForwardTGAGTACCGCAAACGCTTCTC
ReverseTGGACGAGGTTTTTCCACCAG
GAPDHGlyceraldehyde 3-phosphate dehydrogenaseForwardAGGTCATCCCAGAGCTGAACG
ReverseCACCCTGTTGCTGTAGCCGTAT


통계처리

각 실험에서 얻은 결과는 SPSS package program(Ver. 12.0 SPSS Inc., Chicago, IL, USA)을 사용하여 평균과 표준편차로 나타내었다. 각 시료 사이에서 유의성은 P<0.05 수준에서 one-way ANOVA로 분산 분석한 후에 Duncan’s multiple range test로 비교하였다.

인삼농축액 발효식초의 진세노사이드의 함량변화

인삼농축액 2%(w/v), 주정 9%(v/v)에 단일 초산균인 A. pasteurianus JBA190503으로 제조한 종초를 10%(v/v) 첨가하여 진탕배양(30°C, 25일, 120 rpm)하였고, 5일 간격으로 샘플링하여 진세노사이드의 조성변화를 HPLC system을 사용하여 분석하였다. 분석 결과 중 발효 5일차(GV_5day), 발효 15일차(GV_15day), 발효 25일차(GV_25day)의 진세노사이드 크로마토그램은 Fig. 1과 같다. 진세노사이드(G) 표준 mixture 구성분은 G-Rg1, -Re, -Rf, -Rh1, -Rg2, -Rb1, -Rc, -Ra1, -Rb2, -Rb3, -Rd, -Rg3(S), -Rk1, compound K(CK), -Rg5 등 15종이었다. 인삼 종류별 진세노사이드 조성은 인삼(Panax ginseng)의 경우 G-Rb1, -Rb2, -Rc, -Rd, -Re, -Rg1 등의 6종이 총 진세노사이드의 80% 이상을 차지하는 것으로 보고되었다(Christensen, 2008). 본 연구에 사용된 인삼농축액의 진세노사이드 조성비는 이들 6종이 차지하는 비율이 77.73%로 이와 유사하였으나, 초산발효 25일차 시료의 경우 G-Rb1, -Rb2, -Rc, -Rd, -Re, -Rg1 등의 조성비는 57.59%로 감소하였고, G-Rg3, -Rg5, -Rk1의 조성비는 초산발효 전 3.92%에서 초산발효 후 18.56%로 증가하는 경향을 보였다(결과 미제시). 초산발효에 따라 유의적으로 증가한 진세노사이드 성분 G-Rg3, -Rg5, -Rk1 등은 G-Rb1, -Rb2, -Rc 등으로부터 당의 제거와 탈수작용에 의해 전환될 수 있는 것으로 보고되었다(Kang 등, 2013). 한편, G-Rd는 G-Rb1의 C-20 위치에 결합된 Glc1-6Glc 중 한 분자의 glucose가 제거되어 생성되는 구조로 알려졌으나(Nam 등, 2013), 본 연구에서는 증가하는 경향을 보이지 않아 초산발효에 의해 Glc1-6Glc가 동시에 제거되는 것으로 추정된다(Ko 등, 2005).

Fig. 1. HPLC chromatogram of ginseng vinegar with different fermentation period. Ginsenoside (G) standard mix (50 μg/mL): G-Rg1, -Re, -Rf, -Rh1, -Rg2, -Rb1, -Rc, -Ra1, -Rb2, -Rb3, -Rd, -Rg3 (S), -Rk1, compound K (CK), -Rg5, GV_5day: ginseng vinegar fermented for 5 days, GV_15day: gingseng vinegar fermented for 15 days, GV_25day: ginseng vinegar fermented for 25 days.

G-Rg1은 C-20과 C-6에 각각 glucose 한 분자가 결합된구조로 초산발효기간 중 G-Rg1의 함량은 감소하는 경향을 보였으나, G-Rg1의 탈당에 의해 생성되는 것으로 알려진 G-Rh1의 유의적인 증가는 확인되지 않았다(Park, 2019).진세노사이드의 스테로이드 골격에 부착된 수산기가 세포막 인지질의 polar head와 cholesterol의 β-OH와 상호작용을 하여 암세포에 대한 세포독성이 강해지고, 이와 같은 이화학적 상호작용은 진세노사이드의 수산기 및 당 분자 수에 영향을 받는다(Nag 등, 2012). 또한, 동일한 수의 당 분자를 갖는 진세노사이드들의 경우, C-6에 당이 존재하는 진세노사이드는 C-3나 C-20의 위치에 당을 갖는 진세노사이드보다 입체적 장애가 커서 항암 활성 등의 약리 활성이 감소하는 것으로 알려졌다(Nam 등, 2013). 즉, G-Rg1의 구조보다 G-Rb1의 생체이용률이 높고 G-Rg3, -Rg5, -Rk1 등의 생리활성 유용성이 G-Rb1보다 더 높다고 알려져 초산발효에 따른 G-Rg3, -Rg5, -Rk1의 증가는 인삼농축액의 효용성을 증가시킬 것으로 기대된다(Kang 등, 2013).

초산발효에 의해 변화된 진세노사이드 중 G-Rg1, -Rb1, -Rg3, -Rg5의 정량분석 결과는 Fig. 2와 같다. 초산발효기간 중 G-Rg1과 -Rb1의 함량은 발효 5일까지는 유의적인 차이가 없었으나 10일 경과 후부터 유의적인 감소를 나타내었다. 즉, G-Rb1과 -Rg1은 발효 전(0일차)과 발효 후(25일차) 각각 54.71 µg/mL와 192.98 µg/mL에서 21.39 µg/mL와 76.11 µg/mL로 약 2.56배, 2.54배 감소하였다. 반면에 G-Rg3와 -Rg5는 발효 전(0일차) 각각 11.98 µg/mL와7.50 µg/mL 대비 각각 약 4.64배, 3.80배 증가하여 발효 후(25일차) 함량이 55.58 µg/mL와 28.52 µg/mL였다. 특히 초산발효기간 중 총 산도가 4.10% 이상인 10일차 이후 발효물에서 발효기간 경과에 따라 진세노사이드 전환이 증가하여 초산발효가 진세노사이드 전환에 영향을 미치는 것으로 확인할 수 있었다(Table 2, Fig. 2). 즉, 초산농도가 4~6%로 유지되는 산성 환경에서 15일간 지속적인 반응에 의해 당의 제거 및 탈수작용을 촉매하여 인삼농축액의 주요 진세노사이드인 G-Rb1이 G-Rg3 및 G-Rg5 등의 저분자 진세노사이드로 전환된 것으로 추정된다.

Table 2 . Physicochemical properties, organic acid and ethanol contents of ginseng vinegar with different fermentation period

Fermentation time (day)
0510152025
Physicochemical propertiespH4.25±
0.01d1)2)
3.29±
0.01c
2.96±
0.01b
2.98±
0.01b
2.95±
0.01b
2.88±
0.01a
Soluble solids
(°Brix)
5.50±
0.00a
5.55±
0.14a
5.65±
0.14ab
5.65±
0.07ab
5.75±
0.07b
5.75±
0.00b
Total acidity
(%)
0.13±
0.14a
2.39±
0.09b
4.10±
0.02c
5.52±
0.00d
6.05±
0.08e
6.11±
0.02e
Organic acid
(mg% (w/v))
Acetic acid246.05±
25.66a
1,943.36±
54.79b
3,779.66±
52.53c
5,152.33±
109.19d
5,862.84±
79.52e
6,253.01±
21.03f
Succinic acid268.88±
8.99a
202.22±
6.74a
224.1±
38.74a
231.81±
53.95a
239.51±
51.12a
276.92±
0.57a
Citric acid117.81±
1.53a
128.71±
0.34a
155.75±
6.05ab
143.83±
27.21ab
145.96±
25.85ab
171.41±
1.15b
Pyroglutamic acid30.84±
2.33a
25.65±
2.08a
30.21±
0.48a
28.07±
7.59a
29.57±
7.12a
35.34±
0.08a
Total645.772,264.174,189.725,556.046,277.886,736.68
Ethanol (mg% (w/v))7,612.91±
81.85f
5,150.44±
51.77e
4,378.90±
28.11d
4,006.17±
34.03c
3,170.09±
0.99b
1,408.37±
30.65a

1)Values are mean±SD (n=3).

2)Different small letters (a-f) in the same row indicate a significant difference according to Duncan’s multiple test (P<0.05).



Fig. 2. Changes in ginsenosides (G-Rg1, -Rb1, -Rg3, -Rg5) content of ginseng vinegar with different fermentation period. Error bar indicates the standard deviation of mean, and means with the same letter (a-e) are not significantly different according to Duncan’s multiple range test (P<0.05).

인삼농축액 발효식초의 이화학적 특성, 유기산 및 에탄올 함량

인삼농축액의 초산발효기간에 따른 이화학적 특성과 유기산 및 잔류 에탄올의 함량변화를 분석한 결과는 Table 2와 같다. pH는 발효 0일차 4.25에서 발효 25일차에 2.88로 유의적으로 감소하였는데, 이는 발효과정 중 생성된 유기산이 증가하였기 때문으로 판단된다. 수용성 고형분은 발효기간에 따라 증가하는 경향을 보였고, 인삼 진세노사이드에 결합되어 있는 당이 유리됨에 따른 증가로 추정된다. A. pasteurianus JBA190503 균주로 배양된 종초의 총 산도는 2.37%였고, 종초를 10% 첨가한 발효 0일차의 총 산도는 0.13%였다. 특히 진탕배양(30°C, 25일, 120 rpm) 조건에서 인삼농축액에 대한 초산균의 생육 저해는 나타나지 않아 발효 10일 이후 총 산도가 4.10%에 도달하였고, 발효 25일차에는 6.11%에 이르렀다. 식초의 품질 규격은 총 산도 기준으로 4.0%(w/v) 이상으로 고시되어 있지만(KFDA, 2012), 본 연구에서는 진세노사이드의 전환에 초산발효가 미치는 영향을 분석하고자 발효기간을 최대 25일까지 연장하여 발효를 종결하였다.

인삼농축액 발효식초의 주요 유기산은 acetic acid, succinic acid, citric acid, pyroglutamic acid 등으로 확인되었다(Table 2). Acetic acid는 발효 0일차 246.05 mg%에서 25일간 발효 후 약 27.40배 증가하여 6,253.01 mg%로 분석되었다. 또한 기능성 유기산인 citric acid가 인삼농축액에 함유되어 있어 발효 0일차에 117.81 mg%로 분석되었고, 초산발효기간 동안 증가하여 발효 25일차에는 171.41 mg%로 1.5배 증가하였다. Succinic acid 및 pyroglutamic acid는 초산발효기간 중 유의적인 변화를 보이지 않았다. 발효기간 동안 에탄올 함량은 발효 0일차에 7,612.91 mg% (w/v)로 분석되었으며 발효 25일차에는 1,408.37 mg% (w/v)였다. 결과적으로 소비된 에탄올의 함량은 6,204.54 mg%(w/v)였고, 생성된 acetic acid의 함량은 6,006.96 mg% (w/v)로 에탄올의 acetic acid로의 전환율은 약 96.81%였다.

세포독성 평가

마우스 유래 대식세포인 RAW 264.7 세포에 대한 세포독성 평가는 발효 25일차 발효물에 대해서 4% Na2CO3 용액으로 pH를 조정하여 발효 원액에 대한 희석배수 40~100배 수준에서 분석하였다(Fig. 3). 한편, control의 경우 에탄올을 제외한 조성비가 발효 0일차와 같고 에탄올의 독성을 고려하지 않아도 되기 때문에 발효 25일차 발효물과 동일한 희석배수에서 세포독성을 평가하였다. 인삼식초와 control의 세포독성은 ISO 10993-5(2009)의 방법을 참고하여 비처리구와 비교해 30% 이상 감소된 흡광도를 보이는 시료 처리농도를 확인하였고, 오차수준을 고려하여 세포생존율은 80% 이상 유지된 시료 처리농도를 선택하였다. 인삼농축액 발효식초(GV)의 세포생존율은 희석배수 1/100, 1/65, 1/50까지는 시료 비처리구의 생존율 대비 80% 이상의 생존율을 보였으나, 1/40 이상의 경우 80% 미만으로 생존율이 감소하였다. Control의 경우 희석배수 1/40에서도 생존율이 80% 이상으로 유지되었다. 이와 같은 결과는 GV에 잔존하는 에탄올과 acetate 함량이 control과 차이가 나기 때문으로 추정된다. 따라서 GV 시료 처리 시 세포생존율이 80% 이상 유지된 희석배수 1/100, 1/65, 1/50에서 control을 비교구로 하여 항염증 평가를 실시하였다.

Fig. 3. Effect of ginseng vinegar on cell viability in RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50, 1/40 at diluted multiples) for 48 h. GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. Error bar indicates the standard deviation of mean, and means with the same letter (a-c) are not significantly different according to Duncan’s multiple range test (P<0.05).

NO 생성량 및 PGE2 정량

LPS의 자극에 의해 발현된 iNOS는 NO를 생성하게 되고 과도하게 생성된 NO는 염증반응을 촉진하며, LPS 및 cytokine에 의해 발현이 유도된 COX-2는 급성 염증반응에서 PGE2의 합성에 관여한다(Kang 등, 2015). 즉, 대식세포에 LPS를 처리하여 자극시키면 NO와 PGE2의 함량이 증가하고 함께 처리하는 시료가 이들의 생성을 억제하는 것으로 항염증 효과를 평가한다. 마우스 유래 대식세포인 RAW 264.7 세포에 LPS(1 µg/mL)와 함께 GV와 control을 세포독성이 확인되지 않은 희석배율 1/100, 1/65, 1/50로 첨가하여 NO 및 PGE2 생성량을 분석한 결과는 Fig. 4와 같다. RAW 264.7 세포에 LPS를 처리함에 따라 생성된 NO와 PGE2 함량은 각각 25.04 μM과 461.17 pg/mL였으며, GV를 1/100, 1/65, 1/50의 희석배율로 처리함에 따라 NO 함량은 11.97~5.54 μM, PGE2 함량은 405.88~389.41 pg/mL로 감소하였다. Control의 경우 1/100, 1/65, 1/50의 희석배율로 처리함에 따라 NO와 PGE2 함량은 각각 21.08~16.37 μM과 389.41~375.29 pg/mL로 감소하였다. GV와 control의 최고처리 희석배율인 1/50에서는 시료 비처리구에 비해서 NO 생성량이 각각 77.34%와 34.7% 감소하는 것으로 확인되었고, PGE2 함량은 각각 약 21.94%와 19.64%로 감소하였으나 농도 의존성은 보이지 않았다. GV의 경우 G-Rg3와 G-Rg5 등의 저분자 진세노사이드의 함량이 control에 비해 각각 4배와 3배 이상 증가하였고, 이에 따라 NO의 생성량이 감소한 것으로 판단된다(Shin 등, 2013).

Fig. 4. Effect of ginseng vinegar on NO (A) and PGE2 (B) levels in LPS-stimulated RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50 at diluted multiples) then with LPS (1 μg/mL) for 24 h. -: not treated, +: treated, GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. NO: nitric oxide, PGE2: prostaglandin E2. Results are mean±SD of triplicate data. Error bar indicates the standard deviation of mean and means with the same letter (a-f) are not significantly different according to Duncan’s multiple range test (P<0.05). ND: not detected.

세포배양액의 TNF-α 및 IL-1β정량

전염증성 cytokine으로 분류되는 TNF-α와 IL-1β는 세포 내에서 생성된 후 세포 외로 이동하여 염증반응을 촉진하는 역할을 한다(Kim 등, 2017a). 따라서 세포 외로 이동된 TNF-α와 IL-1β의 함량을 분석한 결과는 Fig. 5와 같다. GV와 control의 TNF-α 발현량은 1/50배 희석배수에서 각각 8.06 ng/mL와 13.90 ng/mL였으며, 이는 시료 비처리구에 비해 69.15%와 46.80% 억제능을 보이는 수준이었다. 한편, GV와 control의 IL-1β 억제능은 1/50 희석배수에서 각각 91.76%와 76.29%였다. 또한, GV는 농도 의존적으로 IL-1β 저해 활성을 보였으나 control의 경우 1/100~1/50 희석배수에서 IL-1β 억제능이 유의적인 차이를 보이지 않아 IL-1β 생성억제 효과의 한계점이 약 80%로 추정된다.이와 같은 결과는 G-Rb1이 IL-1β의 생성억제 효과가 높고, control의 1/100 희석배수에 함유된 G-Rb1의 함량이 GV의 1/100과 1/65 희석배수에 비해 많기 때문인 것으로 판단된다(Cheng 등, 2013).

Fig. 5. Effects of ginseng vinegar on TNF-α (A) and IL-1β (B) levels in LPS-stimulated RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50 at diluted multiples) then with LPS (1 μg/mL) for 24 h. -: not treated, +: treated, GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. TNF-α: tumor necrosis factor-α, IL-1β: interleukin-1β. Results are mean±SD of triplicate data. Error bar indicates the standard deviation of mean, and means with the same letter (a-f) are not significantly different according to Duncan’s multiple range test (P<0.05). ND: not detected.

iNOS 및 COX-2 mRNA 발현 비교

RAW 264.7 세포에 LPS 자극을 통해 염증반응을 유발하였을 경우, NO 및 PGE2의 생성량은 iNOS와 COX-2 발현량에 영향을 받는다. 따라서 세포 내 mRNA 수준에서 iNOS와 COX-2 발현 정도를 확인하기 위해 RT-PCR을 수행하였고 house keeping gene인 GAPDH를 양성 대조구로 하여 비교하였다(Fig. 6). iNOS는 LPS 비처리구(-)에서 발현되지 않았으나 LPS 처리구(+)에서는 70.03%의 발현량이 확인되었다. GV를 1/100, 1/65, 1/50 희석배수에서 처리하였을 때 iNOS의 발현량은 각각 39.21, 27.41, 27.15%로 감소하였고, 희석배수에 대한 발현량의 분산분석 및 동질성 검사 결과 1/100과 1/50의 희석배수에서 희석배수 의존적으로 유의하게 발현량이 감소하였다. 그러나 1/65과 1/50의 유의적인 차이는 없어 1/65 희석배수에서 iNOS 발현량이 시료 비처리구에 비해 42.62% 감소한 효과를 보였다. 또한, 1/50 희석배수에서 GV와 control 처리에 따른 iNOS 발현 억제능은 시료 비처리구 대비 각각 61.23%와 39.00% 수준이었다. COX-2의 발현량은 LPS 비처리구(-)와 LPS 처리구(+)가 각각 22.90%와 50.44%였으며 GV의 1/50 희석배수에서는 40.06%로 발현이 크게 감소하였다. 이러한 결과로 보아 GV의 iNOS 발현 억제에 의한 NO 생성량 감소와 COX-2 발현 억제에 의한 PGE2 생성 억제 효과가 1/50 희석배수에서 확인되었다. Kang 등(2018)은 인삼의 진세노사이드에 대한 항염증 연구에서 G-Rg3, -Rg5, -Rk1 등의 저분자 진세노사이드들이 G-Rb1의 항염증 효과보다 더 효과적이라 보고하였다. 본 연구에서는 초산발효를 통해 G-Rg3 및 G-Rg5 등의 전환이 증가하여 iNOS 및 COX-2의 mRNA 수준에서 발현이 감소하고, 이에 따라 염증반응이 억제된 것이라 판단된다(Lee, 2014).

Fig. 6. Effects of ginseng vinegar on iNOS (A) and COX-2 (B) mRNA expression in LPS-stimulated RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50 at diluted multiples) then with LPS (1 μg/mL) for 24 h. The results were analyzed by RT-PCR. -: not treated, +: treated, GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. iNOS: inducible nitric oxide synthase, COX-2: cyclooxygenase-2, GAPDH: glyceraldehyde 3-phosphate dehydrogenase, LPS: lipopolysaccharides. Results are mean±SD of triplicate data. Error bar indicates the standard deviation of mean and means with the same letter (a-f) are not significantly different according to Duncan’s multiple range test (P<0.05). ND: not detected.

인삼농축액 발효식초 제조를 위한 인삼주(GL, 1% yeast extract, 9% 에탄올, 2% 인삼농축액)에 A. pasteurianus JBA190503 균주로 제조한 종초 10%(v/v)를 첨가하고, 진탕배양(30°C, 120 rpm, 25일)하여 초산발효 하였다. 인삼식초의 발효기간(25일)에 5일 간격으로 진세노사이드 함량변화와 이화학적 특성, 유기산 및 에탄올의 함량을 분석하였다. G-Rg3와 -Rg5의 함량은 0일차에 비해 25일차에 각각 4.64배, 3.80배 증가하였다. 인삼식초는 발효 10일차 총 산도가 4.10%에 도달하였으나, 25일까지 초산발효를 지속하여 진세노사이드의 함량변화를 분석하고 발효를 종결하였다. GV의 총 산도는 6.11%, acetic acid는 6,253.01 mg%였으며 초산 전환율은 96.81%였다. RAW 264.7 대식세포에 LPS 자극으로 염증을 유도하고 세포생존율이 80% 이상 확인된 GV와 control의 1/100, 1/65, 1/50의 희석액을 처리하여 항염증 효과를 평가하였다. GV의 처리는 희석배수 의존적으로 염증 관련 인자(NO, PGE2), 전염증성 cytokine (TNF-α, IL-1β) 생성 및 염증 관련 유전자(iNOS, COX-2)의 발현을 억제시켰다. 따라서 GV의 항염증 효과는 1/50 희석배수에서 비처리구 대비 NO, PGE2, TNF-α 및 IL-1β 생성을 각각 77.37%, 21.94%, 69.17% 및 91.76% 억제하였고, iNOS 및 COX-2의 mRNA 수준에서 발현을 61.23% 및 20.59% 억제하였다. 이러한 결과를 바탕으로 A. pasteurianus JBA190503 균주로 제조된 인삼농축액 발효식초는 상업용 식초로서 품질과 안전성이 확보된 항염증 효과가 증대된 기능성 식초로 기대된다.

본 논문은 농림축산식품부 지역 전략 식품산업 육성사업(과제명: 임산물 기반 동부권 발효식초개발, MIFI 2020-1)의 연구비 지원으로 이루어졌으며, 이에 감사드립니다.

  1. Cheng LQ, Na JR, Bang MH, Kim MK, Yang DC. Conversion of major ginsenoside Rb1 to 20(S)-ginsenoside Rg3 by Microbacterium sp. GS514. Phytochemistry. 2008. 69:218-224.
    Pubmed CrossRef
  2. Cheng W, Wu D, Zuo Q, Wang Z, Fan W. Ginsenoside Rb1 prevents interleukin-1 beta induced inflammation and apoptosis in human articular chondrocytes. Int Orthop. 2013. 37: 2065-2070.
    Pubmed KoreaMed CrossRef
  3. Choi WY, Lee CG, Seo YC, Song CH, Lim HW, Lee HY. Effect of high pressure and steaming extraction processes on ginsenosides Rg3 and Rh2 contents of cultured-root in wild ginseng (Panax ginseng C. A. Meyer). Korean J Med Crop Sci. 2012. 20:270-276.
    CrossRef
  4. ISO 10993-5. Determination of cytotoxicity. In: Biological evaluation of medical devices-Part 5: Test for in vitro cytotoxicity. International Organization for Standardization, Geneva, Switzerland. 2009. p 9-10.
  5. Kang BK, Kim KBWR, Kim MJ, Bark SW, Park WM, Ahn NK, et al. Anti-inflammatory effect of Sargassum coreanum ethanolic extract through suppression of NF-κβ pathway in LPS induced RAW 264.7 cells in mice. Microbiol Biotechnol Lett. 2015. 43:112-119.
    CrossRef
  6. Kang KS, Ham J, Kim YJ, Park JH, Cho EJ, Yamabe N. Heatprocessed Panax ginseng and diabetic renal damage: active components and action mechanism. J Ginseng Res. 2013. 37: 379-388.
    Pubmed KoreaMed CrossRef
  7. Kang S, Park SJ, Lee AY, Huang J, Chung HY, Im DS. Ginsenoside Rg3 promotes inflammation resolution through M2 macrophage polarization. J Ginseng Res. 2018. 42:68-74.
    Pubmed KoreaMed CrossRef
  8. KFDA. Food code. Korea Food and Drug Administration, Osong, Korea. 2012. p 5-21.
  9. Kim HK, Cheon BS, Kim YH, Kim SY, Kim HP. Effects of naturally occurring flavonoids on nitric oxide production in the macrophage cell line RAW 264.7 and their structure-activity relationships. Biochem Pharmacol. 1999. 58:759-765.
    CrossRef
  10. Kim HW, Shin KS. Immunomodulatory and anti-metastatic activities of a crude polysaccharide isolated from Korean apple vinegar. Korean J Food Sci Technol. 2019. 51:152-159.
  11. Kim MJ, Kim KBWR, Park SH, Choi JS, Ahn DH. Anti-inflammatory effect of Chondria crassicaulis ethanol extract on MAPKs and NF-κβ signaling pathway in LPS-induced RAW 264.7 macrophages. Korean Soc Biotechnol Bioeng J. 2017a. 32:352-360.
    CrossRef
  12. Kim MK, Kim DY. Anti-inflammatory effect of barley leaf ethanol extract in LPS-stimulated RAW264.7 macrophage. Korean J Food Preserv. 2015. 22:735-743.
    CrossRef
  13. Kim MY, Lee JB, Yang BW, Park JD, Ko SK. The comparison of ginseng saponin composition and contents in steaming ginseng radix. Yakhak Hoeji. 2017b. 61:274-280.
    CrossRef
  14. Kim YS, Song GS. Characteristics of kiwifruit-added traditional kochujang. Korean J Food Sci Technol. 2002. 34:1091-1097.
  15. Ko SK, Lee KH, Hong JK, Kang SA, Sohn UD, Im BO, et al. Change of ginsenoside composition in ginseng extract by vinegar process. Food Sci Biotechnol. 2005. 14:509-513.
  16. Ko SR, Suzuki Y, Suzuki K, Choi KJ, Cho BG. Marked production of ginsenosides Rd, F2, Rg3, and compound K by enzymatic method. Chem Pharm Bull. 2007. 55:1522-1527.
    Pubmed CrossRef
  17. Lee SM. Anti-inflammatory effects of ginsenosides Rg5, Rz1, and Rk1: inhibition of TNF-α-induced NF-κB, COX-2, and iNOS transcriptional expression. Phytother Res. 2014. 28:1893-1896.
    Pubmed CrossRef
  18. MFDS (Ministry of Food and Drug Safety). 2017 Korea food safety. 2017 [cited 2020 Dec 03]. Available from: https://www.foodsafetykorea.go.kr/portal/safefoodlife/foodMeterial/foodMeterialDB.do?menu_grp=MENU_NEW04&menu_no=2968
  19. Nag SA, Qin JJ, Wang W, Wang MH, Wang H, Zhang R. Ginsenosides as anticancer agents: in vitro and in vivo activities, structure-activity relationships, and molecular mechanisms of action. Front Pharmacol. 2012. 3:25. https://doi.org/10.3389/fphar.2012.00025
    Pubmed KoreaMed CrossRef
  20. Nam KY, Choi JE, Park JD. Transformation techniques for the large scale production of ginsenoside Rg3. Korean J Med Crop Sci. 2013. 21:401-414.
    CrossRef
  21. Nam KY, Kim YS, Shon MY, Park JD. Recent advances in studies on chemical constituents and biological activities of Korean black ginseng (Panax ginseng C. A. Meyer). Kor J Pharmacogn. 2015. 46:173-188.
  22. Park H. The role of gut microbiota in ginsenoside metabolism and biotransformation of ginsenoside by lactic acid bacteria. Curr Top Lact Acid Bact Probiotics. 2019. 5:1-12.
    CrossRef
  23. Park JD. Recent studies on the chemical constituents of Korean ginseng (Panax ginseng C. A. Meyer). Korean J Ginseng Sci. 1996. 20:389-415.
  24. Ryu JH, An JH, Woo YK, Cho HJ. The anti-inflammation effects of A.C.C extracts on the LPS-induced RAW 264.7 cell. J Korea Acad-Indus Coop Soc. 2017. 18:503-511.
  25. Shin YM, Jung HJ, Choi WY, Lim CJ. Antioxidative, anti-inflammatory, and matrix metalloproteinase inhibitory activities of 20(S)-ginsenoside Rg3 in cultured mammalian cell lines. Mol Biol Rep. 2013. 40:269-279.
    Pubmed CrossRef
  26. Sung NH, Woo SM, Kwon JH, Yeo SH, Jeon YJ. Quality characteristics of high acidity apple vinegar manufactured using two stage fermentation. J Korean Soc Food Sci Nutr. 2014. 43:877-883.
    CrossRef

Article

Article

Journal of the Korean Society of Food Science and Nutrition 2021; 50(3): 226-235

Published online March 31, 2021 https://doi.org/10.3746/jkfn.2021.50.3.226

Copyright © The Korean Society of Food Science and Nutrition.

인삼농축액 발효식초의 진세노사이드 전환 및 RAW 264.7 세포에 대한 항염증 효과

문경은1?오현화1?정도연2?김영수1

1전북대학교 식품공학과 2(재)발효미생물산업진흥원

Received: December 4, 2020; Revised: January 6, 2021; Accepted: January 7, 2021

Ginsenoside Conversion and Anti-Inflammatory Effect on RAW 264.7 Cells of Ginseng Extract Vinegar

Kyung Eun Moon1 , Hyeon Hwa Oh1, Do Youn Jeong2, and Young-Soo Kim1

1Department of Food Science and Technology, Jeonbuk National University
2Microbial Institute for Fermentation Industry (MIFI)

Correspondence to:Young-Soo Kim, Department of Food Science and Technology, Jeonbuk National University, 567, Baekjedaero, Deokjin-gu, Jeonju-si, Jeonbuk 54896, Korea, E-mail: ykim@jbnu.ac.kr
Author information: Kyung Eun Moon (Graduate student), Hyeon Hwa Oh (Researcher), Young-Soo Kim (Professor)

Received: December 4, 2020; Revised: January 6, 2021; Accepted: January 7, 2021

Abstract

Ginseng liqueur (GL) was prepared by adding 9% alcohol to 2% ginseng extract, and was fermented using the selected Acetobacter pasteurianus JBA190503 strain. To another GL, 10% of the seed culture was added and incubated in a shaking incubator at 30°C and 120 rpm for 25 days. The ginsenoside contents of Rg3 and Rg5 in the ginseng extract vinegar (GV) were 55.58 μg/mL and 28.52 μg/mL, respectively, which were more than four times that of GL. The changes in the ginsenoside contents and physicochemical properties (soluble sugar content, pH, total acidity, and organic acid) of the ginseng extract were evaluated during the acetic acid fermentation period. On the 10th day of fermentation, the total acidity increased to 4.10% and reached 6.41% on the 25th day. Acetic acid was identified as a major organic acid and its content was increased to 6,253.01 mg% on the 25th day from 246.05 mg% on the starting day. The anti-inflammatory effect on lipopolysaccharide (LPS, 1 μg/mL)-induced inflammatory reactions in RAW 264.7 cells demonstrated that treatment with GV decreased NO, PGE2, TNF-α and IL-1β production in RAW 264.7 cells by 77.37%, 21.94%, 69.17%, and 91.76%, respectively, and GV inhibited the activation of iNOS and COX-2 gene expression by 61.23% and 20.59%, respectively, at a 1:50 dilution. Based on these findings, the A. pasteurianus JBA190503 strain could be a suitable strain for the industrial fermentation of ginseng in ginseng vinegar production with an enhanced anti-inflammatory effect by increasing the production of low molecular ginsenosides and acetic acid.

Keywords: ginseng liqueur, ginseng extract vinegar, ginsenoside, anti-inflammatory

서 론

인삼(Panax ginseng C.A. Meyer)의 주요 유효성분인 진세노사이드(G)는 지금까지 약 40여 종 이상의 구조가 분리 동정되었고(Cheng 등, 2008), 이들 진세노사이드 가운데 G-Rg3는 G-Rg1과 G-Rb1에 이어 가장 많이 연구된 성분으로 항암효과, 항산화 활성, 신경보호, 혈관이완, 항당뇨 및 면역 조절 등의 다양한 약리효과가 알려져 있다(Kim 등, 2017b; Nam 등, 2013). 그러나 G-Rg3는 인삼 천연상태에는 거의 존재하지 않으며 G-Rb1 등과 같은 protopanaxadiol(PPD)계 사포닌의 성분 변환에 의해 생성되는 것으로 보고된다(Park, 1996). 고분자 G-Rb1에서 C-20 위치 gly-cosyl moiety가 제거되어 G-Rg3(S, R)로 전환되며, G-Rg3는 탈수반응을 통해 G-Rg5 및 G-Rk1 등으로 전환된다(Nam 등, 2015). G-Rb1의 구조보다 생리활성이 높은 것으로 알려진 G-Rg3로의 전환량 증가를 위해 고온・고압 및 증숙 가공 또는 미생물을 이용한 발효나 유기산 처리 등이 보고되었다(Nam 등, 2013). 그러나 고온 및 증숙 가공법은 고에너지 요구 및 증숙 과정 중 생성되는 것으로 알려진 벤조피렌 등의 발암물질에 대한 문제점을 가지고 있다(Choi 등, 2012). 미생물을 이용하는 경우에는 식품에 적용 가능하여야 하고 효소적 처리보다 전환율이 상대적으로 낮은 어려움이 있으며, 효소처리의 경우에는 고비용의 정제효소를 사용해야 하는 어려움 때문에 식품산업 적용에 비효율적이다(Ko 등, 2007). 한편, 유기산 처리에 의한 G-Rg3 전환에 대한 연구는 산가수분해 후 생성된 G-Rg3가 산성 상태의 노출에 의해 G-Rg5, -Rk1 등으로 전환되는 경향을 시사하였다(Nam 등, 2013).

초산을 주성분으로 하는 식초는 체지방 감소, 피로회복, 성인병 예방 등의 효과와 더불어 식초 원료에 따른 다양한 유리당, 유기산, 에스터 및 기능성 물질이 함유되어 있다(Sung 등, 2014). 특히 식초의 기능성이 강조되면서 천연발효 식초를 중심으로 단순한 조미 용도에서 기능성 소재 및 건강식품으로도 이용되고 있으며, 이에 따라 고품질의 발효 식초 소비가 증가하고 있다(Kim과 Shin, 2019). 천연발효 식초에 대한 관심이 증가함에 따라 안전하고 균일한 품질의 발효 식초를 생산하는 것이 중요하며, 이를 위해서는 GRAS (generally regarded as safe) 초산균을 사용해야 하지만 현재 식품 원료로 사용될 수 있는 초산균은 Acetobacter pasteurianusAcetobacter aceti 2종이다(MFDS, 2017).

염증반응은 면역세포가 물리적 또는 화학적 자극이나 세균감염을 인지한 후 다양한 염증매개 물질을 분비하여 손상된 부위를 정상상태로 되돌리려는 생체의 방어기전이다(Kim 등, 2017a). 특히 신체에서 동맥경화, 당뇨병, 관절염 및 암과 같은 다양한 질병의 원인인 만성 염증으로 지속적인 염증반응이 일어나게 되어 점막손상이 촉진된다(Ryu 등, 2017). 염증반응과 관련된 유전인자, cytokine 및 염증매개 인자들은 대식세포에 lipopolysaccharides(LPS) 등을 인위적으로 처리하면 유발될 수 있고, 항염증 효과를 가진 물질들은 이와 관련된 반응 산물들의 생성량을 감소시킨다(Kim과 Kim, 2015). G-Rg3, -Rg5, -Rk1 등의 저분자 진세노사이드는 G-Rb1의 경우보다 더 효과적으로 염증반응을 억제시키는것으로 보고되었다(Lee, 2014).

재료 및 방법

재료 및 시약

인삼주 및 인삼식초 제조를 위해 인삼농축액(Ilhwa Co., Ltd., Jinan, Korea), 순창샘물(Lotus Co., Ltd., Sunchang, Korea), 주정(95.6%, Ethanol Korea Co., Ltd., Seongnam, Korea) 등을 사용하였다. 미생물의 배양을 위한 배지는 BD 사(Franklin Lakes, NJ, USA)에서 구입하여 사용하였다. 세포배양을 위한 Dulbecco’s modified Eagle’s medium(DMEM), bovine calf serum(BCS), fetal bovine serum(FBS), antibiotics(penicillin/streptomycin), Dulbecco’s phosphate-buffered saline(DPBS)은 Gibco BRL(Grand Island, NY, USA) 제품을 사용하였으며, 세포독성 측정을 위하여 cell counting kit-8(CCK-8, Dojindo Molecular Technologies Inc., Rockville, MD, USA) 제품을 사용하였다. 염증유발 및 확인을 위해 lipopolysaccharides from Escherichia coli(LPS, Sigma-Aldrich Co., St. Louis, MO, USA), NaNO2(Alfa Aesar Co., Haverhill, MA, USA), Griess reagent(Sigma-Aldrich Co.), 세포배양액 내의 tumor necrosis factor-α(TNF-α), interleukin-1β(IL-1β), prostaglandin E2(PGE2) 함량은 R&D System사(Minneapolis, MN, USA)의 ELISA kit을 구입하여 측정하였다. Total RNA 추출을 위해 Qiagen RNeasy mini kit(QIAGEN, Hilden, Germany), cDNA 합성을 위해 Go ScriptTM Reverse Transcription system(Promega, Madison, WI, USA) 제품을 사용하였다. 그 밖의 시약들은 HPLC grade를 사용하였다.

인삼농축액 발효식초 제조

시판식초로부터 분리 선발된 A. pasteurianus JBA190503은 GYE 평판배지(1% yeast extract, 5% glucose, 6% ethanol, 2.5% agar)에 도말하고 정치배양기(HB-101M, Hanbaek Scientific Co., Ltd., Bucheon, Korea)에서 활성화(30°C, 3일)시켜 단일 콜로니를 취해 YEg2 액체배지(1% yeast extract, 6% 에탄올, 2% 인삼농축액)에 1 백금이 접종한 후 진탕배양(30°C, 3일, 120 rpm)하여 종초를 제조하였다. 인삼농축액 발효식초 제조를 위한 인삼주(1% yeast extract, 9% 에탄올, 2% 인삼농축액)는 YEg2 액체배지 조성에서 에탄올의 첨가농도를 6%에서 9%로 상향 조정하여 제조하였다. 제조된 인삼주에 종초를 10%(v/v) 첨가하고 진탕배양기(SI-2S, Universal Scientific Industrial Co., Ltd., Shanghai, China)에서 배양(30°C, 120 rpm)하면서 발효 0일차부터 발효 25일차까지 5일 간격으로 샘플링하여 총 산도 증가 여부로 초산발효를 확인하였다. 세포실험을 위한 대조구(control)는 발효 0일차(1% yeast extract, 9% 에탄올, 2% 인삼농축액, 10% 종초)의 조성에서 에탄올 대신 동량의 물을 첨가하여 제조하였고, 제조 즉시 -20°C에 보관하여 차후 실험에 사용하였다.

진세노사이드 함량 측정

인삼농축액 발효식초의 발효기간 중 진세노사이드 함량은 HPLC system(Waters e2695, Waters, Milford, MA, USA)을 사용하여 분석하였으며, 사용된 시료는 0.22 μm membrane filter(Futecs Co., Ltd., Daejeon, Korea)로 여과하여 사용하였다. 진세노사이드 표준물질 mixture는 진안홍삼연구소(Jinan, Korea)로부터 공급받아 정성분석에 사용하였고, G-Rg1(98.4%), G-Rb1(97%), G-Rg3(94.3%), G-Rg5(85%)의 전환을 확인하기 위해 ChromaDex(Los Angeles, CA, USA)로부터 구입하여 정량분석에 사용하였다.

HPLC system에서 사용된 컬럼은 Kinetex의 C18(50×4.6 mm, ID 2.6 μm, Torrance, CA, USA)이었다. 컬럼의 온도는 35°C, 유속은 1.6 mL/min, 시료 주입량은 10 μL였으며, 이동상으로 용매 A는 acetonitrile, 용매 B는 water를 선정하였다. 시간에 따른 용매 조건은 A를 기준으로 나타내었으며, 0~10 min: 18%, 10~40 min: 20%, 40~45 min: 30%, 45~60 min: 37%, 60~65 min: 64%, 65~70 min: 95%로 증가시키고, 75 min까지는 95%로 유지한 후 75~90 min은 18%로 감소시키도록 설정하였다. 검출기는 pho-todiode array detecter(Waters 996, Waters)를 사용하였으며 203 nm에서 검출하였다. 분리된 진세노사이드의 각 peak는 동일 조건에서 분석한 표준물질 mixture의 peak 면적비와 retention time을 비교하여 함량을 산출하였다.

이화학적 특성, 유기산 및 에탄올 함량

인삼식초 발효기간 중 이화학적 특성 변화는 pH, 수용성 고형분 함량 및 총 산도를 측정하여 비교하였다. pH는 pH meter(PP-20, Sartorius, Göttingen, Germany)를 사용하여 측정하였고, 수용성 고형분 함량은 당도계(PAL-1, ATAGO Co., Tokyo, Japan)를 사용하여 측정한 후 °Brix 단위로 표기하였다. 총 산도는 시료에 0.1 N NaOH를 첨가하여 pH 8.3에 도달할 때까지 소모된 NaOH 적정양(mL)을 acetic acid의 환산계수를 곱하여 백분율(%)로 산출하였다.

인삼식초 발효기간 중 유기산 및 잔류 에탄올의 변화는 Kim과 Song(2002)의 방법을 사용하여 측정하였다. 시료를 희석하여 0.22 μm membrane filter로 여과하여 HPLC system(Shimadzu Co., Kyoto, Japan)으로 분석하였다. HPLC system에서 사용된 컬럼은 Aminex HPX87H ion exclusion column(300×7.8 mm, 9 μm, Bio-Rad Labs., Richmond, CA, USA)이었다. 분석조건은 이동상 0.008 M H2SO4, 유속 0.6 mL/min, 컬럼 온도는 35°C였다. 유기산은 UV-VIS detector(SPD-10A, Shimadzu Co.)를 사용하여 210 nm 파장에서 검출하였고, 에탄올은 RID detecter(RID-10A, Shimadzu Co.)를 사용하여 분석하였다. 유기산 정량을 위한 표준물질 citric acid, succinic acid, pyroglutamic acid, acetic acid는 Sigma-Aldrich Co.로부터 구입하여 사용하였으며, 분리된 유기산 및 에탄올의 각 peak는 동일 조건에서 분석한 표준물질 mixture의 peak 면적비와 retention time을 비교하여 함량을 산출하였다.

세포배양 및 세포생존율 측정

항염증 실험을 위한 세포주는 마우스 유래 대식세포인 RAW 264.7 세포(KCLB No. 40071; Korea Cell Line Bank, Seoul, Korea)를 분양받아 사용하였다. 세포배양액은 10% FBS, 1% penicillin/streptomycin을 함유한 DMEM 배지로 하여 5% CO2 incubator(MCO-18AC, Panasonic Healthcare Co., Ltd., Osaka, Japan)에서 37°C 항온을 유지하면서 배양하였다. 계대배양 후 RAW 264.7 세포는 96-well plate에 5×103 cells/well의 밀도로 분주하여 5% CO2 in-cubator에서 37°C 항온을 유지하면서 24시간 배양하였다. 인삼농축액 발효식초와 대조구를 시료로 하여 원액을 40~100배까지 희석하여 희석배수별로 처리하고 48시간 배양하였다. 배양 48시간 후 배지를 제거하고 PBS 100 µL와 CCK-8 solution 10 µL를 첨가하여 암실의 5% CO2 in-cubator에서 2시간 반응하였다. 반응 후 microplate reader(US/Eon, BioTek Instruments, Inc., Winooski, VT, USA)를 사용하여 450 nm에서 흡광도를 측정하였다. 세포생존율은 시료 비첨가구의 흡광도 값에 대한 각 시료 첨가구의 흡광도 값을 백분율로 계산하여 나타내었다.

NO 생성량 및 PGE2 정량

96-well plate에 세포를 5×104 cells/well의 밀도로 분주하여 5% CO2로 조정된 37°C incubator에서 24시간 배양한 후 LPS(1 μg/mL)와 희석배수별로 희석된 시료를 동시에 처리하여 24시간 배양하였다. 배양 후 배양 상등액을 일정량 수거하여 NO 및 PGE2 분석에 이용하였다. NO 생성량 측정은 Kim 등(1999)의 방법을 변형해 진행하였고, Griess reagent와 세포배양액의 반응 후 540 nm에서 흡광도를 측정하여 nitrite 표준용액의 정량곡선을 기준으로 NO 생성량을 산출하였다. PGE2는 PGE2 ELISA kit을 이용하여 제조사의 지시에 따라 측정하였다.

세포배양액의 TNF-α 및 IL-1β정량

96-well plate에 세포를 5×104 cells/well의 밀도로 분주하여 5% CO2로 조정된 37°C incubator에서 24시간 배양한 후 LPS(1 μg/mL)와 희석배수별로 희석된 시료를 동시에 처리하여 24시간 배양하였다. 세포배양 상등액 내의 TNF-α와 IL-1β의 분비량은 ELISA kit을 이용하여 제조사의 지시에 따라 측정하였다.

iNOS 및 COX-2 mRNA 발현 비교

12-well plate에 세포를 5×105 cells/well의 밀도로 분주하여 5% CO2로 조정된 37°C incubator에서 24시간 배양한 후 LPS(1 μg/mL)와 희석배수별로 희석된 시료를 동시에 처리하여 24시간 배양하였다. 배양 후 PBS로 2회 세척하여 Qiagen RNeasy mini kit으로 total RNA를 추출하였다. Total RNA는 GoStriptTM Reverse Transcription system을 이용하여 cDNA로 합성하였고, 합성된 cDNA는 micro-plate reader를 이용하여 정량한 후 이를 template로 사용하여 polymerase chain reaction(PCR)을 진행하였다. PCR 결과물은 1.5% agarose gel을 이용하여 전기영동하고, chemidoc system(c600, Azure Biosystems Inc., Dublin, CA, USA)을 사용하여 밴드를 확인하였다. Image J gel analysis software(NIH, Bethesda, MD, USA)를 이용하여 glyceraldehydes-3-phosphate dehydrogenase(GAPDH)에 대한 iNOS 및 COX-2 발현량을 분석하였다. 실험에 사용한 primer 염기서열은 Table 1과 같다. PCR 조건은 초기 변성(95°C, 2분), denaturation(95°C, 30초), annealing (56°C, 30초), polymerization(72°C, 1분) 순서로 하여 30 cycle을 진행하였고, 72°C에서 10분간 처리하여 종결하였다.

Table 1 . The primer sequence used in the experiment.

Target geneGene full nameDirectionPrimer sequence (5′→3′)
iNOSInducible nitric oxide synthaseForwardATGTCCGAAGCAAACATCAC
ReverseTAATGTCCAGGAAGTAGGTG
COX-2Cyclooxygenase-2ForwardTGAGTACCGCAAACGCTTCTC
ReverseTGGACGAGGTTTTTCCACCAG
GAPDHGlyceraldehyde 3-phosphate dehydrogenaseForwardAGGTCATCCCAGAGCTGAACG
ReverseCACCCTGTTGCTGTAGCCGTAT


통계처리

각 실험에서 얻은 결과는 SPSS package program(Ver. 12.0 SPSS Inc., Chicago, IL, USA)을 사용하여 평균과 표준편차로 나타내었다. 각 시료 사이에서 유의성은 P<0.05 수준에서 one-way ANOVA로 분산 분석한 후에 Duncan’s multiple range test로 비교하였다.

결과 및 고찰

인삼농축액 발효식초의 진세노사이드의 함량변화

인삼농축액 2%(w/v), 주정 9%(v/v)에 단일 초산균인 A. pasteurianus JBA190503으로 제조한 종초를 10%(v/v) 첨가하여 진탕배양(30°C, 25일, 120 rpm)하였고, 5일 간격으로 샘플링하여 진세노사이드의 조성변화를 HPLC system을 사용하여 분석하였다. 분석 결과 중 발효 5일차(GV_5day), 발효 15일차(GV_15day), 발효 25일차(GV_25day)의 진세노사이드 크로마토그램은 Fig. 1과 같다. 진세노사이드(G) 표준 mixture 구성분은 G-Rg1, -Re, -Rf, -Rh1, -Rg2, -Rb1, -Rc, -Ra1, -Rb2, -Rb3, -Rd, -Rg3(S), -Rk1, compound K(CK), -Rg5 등 15종이었다. 인삼 종류별 진세노사이드 조성은 인삼(Panax ginseng)의 경우 G-Rb1, -Rb2, -Rc, -Rd, -Re, -Rg1 등의 6종이 총 진세노사이드의 80% 이상을 차지하는 것으로 보고되었다(Christensen, 2008). 본 연구에 사용된 인삼농축액의 진세노사이드 조성비는 이들 6종이 차지하는 비율이 77.73%로 이와 유사하였으나, 초산발효 25일차 시료의 경우 G-Rb1, -Rb2, -Rc, -Rd, -Re, -Rg1 등의 조성비는 57.59%로 감소하였고, G-Rg3, -Rg5, -Rk1의 조성비는 초산발효 전 3.92%에서 초산발효 후 18.56%로 증가하는 경향을 보였다(결과 미제시). 초산발효에 따라 유의적으로 증가한 진세노사이드 성분 G-Rg3, -Rg5, -Rk1 등은 G-Rb1, -Rb2, -Rc 등으로부터 당의 제거와 탈수작용에 의해 전환될 수 있는 것으로 보고되었다(Kang 등, 2013). 한편, G-Rd는 G-Rb1의 C-20 위치에 결합된 Glc1-6Glc 중 한 분자의 glucose가 제거되어 생성되는 구조로 알려졌으나(Nam 등, 2013), 본 연구에서는 증가하는 경향을 보이지 않아 초산발효에 의해 Glc1-6Glc가 동시에 제거되는 것으로 추정된다(Ko 등, 2005).

Fig 1. HPLC chromatogram of ginseng vinegar with different fermentation period. Ginsenoside (G) standard mix (50 μg/mL): G-Rg1, -Re, -Rf, -Rh1, -Rg2, -Rb1, -Rc, -Ra1, -Rb2, -Rb3, -Rd, -Rg3 (S), -Rk1, compound K (CK), -Rg5, GV_5day: ginseng vinegar fermented for 5 days, GV_15day: gingseng vinegar fermented for 15 days, GV_25day: ginseng vinegar fermented for 25 days.

G-Rg1은 C-20과 C-6에 각각 glucose 한 분자가 결합된구조로 초산발효기간 중 G-Rg1의 함량은 감소하는 경향을 보였으나, G-Rg1의 탈당에 의해 생성되는 것으로 알려진 G-Rh1의 유의적인 증가는 확인되지 않았다(Park, 2019).진세노사이드의 스테로이드 골격에 부착된 수산기가 세포막 인지질의 polar head와 cholesterol의 β-OH와 상호작용을 하여 암세포에 대한 세포독성이 강해지고, 이와 같은 이화학적 상호작용은 진세노사이드의 수산기 및 당 분자 수에 영향을 받는다(Nag 등, 2012). 또한, 동일한 수의 당 분자를 갖는 진세노사이드들의 경우, C-6에 당이 존재하는 진세노사이드는 C-3나 C-20의 위치에 당을 갖는 진세노사이드보다 입체적 장애가 커서 항암 활성 등의 약리 활성이 감소하는 것으로 알려졌다(Nam 등, 2013). 즉, G-Rg1의 구조보다 G-Rb1의 생체이용률이 높고 G-Rg3, -Rg5, -Rk1 등의 생리활성 유용성이 G-Rb1보다 더 높다고 알려져 초산발효에 따른 G-Rg3, -Rg5, -Rk1의 증가는 인삼농축액의 효용성을 증가시킬 것으로 기대된다(Kang 등, 2013).

초산발효에 의해 변화된 진세노사이드 중 G-Rg1, -Rb1, -Rg3, -Rg5의 정량분석 결과는 Fig. 2와 같다. 초산발효기간 중 G-Rg1과 -Rb1의 함량은 발효 5일까지는 유의적인 차이가 없었으나 10일 경과 후부터 유의적인 감소를 나타내었다. 즉, G-Rb1과 -Rg1은 발효 전(0일차)과 발효 후(25일차) 각각 54.71 µg/mL와 192.98 µg/mL에서 21.39 µg/mL와 76.11 µg/mL로 약 2.56배, 2.54배 감소하였다. 반면에 G-Rg3와 -Rg5는 발효 전(0일차) 각각 11.98 µg/mL와7.50 µg/mL 대비 각각 약 4.64배, 3.80배 증가하여 발효 후(25일차) 함량이 55.58 µg/mL와 28.52 µg/mL였다. 특히 초산발효기간 중 총 산도가 4.10% 이상인 10일차 이후 발효물에서 발효기간 경과에 따라 진세노사이드 전환이 증가하여 초산발효가 진세노사이드 전환에 영향을 미치는 것으로 확인할 수 있었다(Table 2, Fig. 2). 즉, 초산농도가 4~6%로 유지되는 산성 환경에서 15일간 지속적인 반응에 의해 당의 제거 및 탈수작용을 촉매하여 인삼농축액의 주요 진세노사이드인 G-Rb1이 G-Rg3 및 G-Rg5 등의 저분자 진세노사이드로 전환된 것으로 추정된다.

Table 2 . Physicochemical properties, organic acid and ethanol contents of ginseng vinegar with different fermentation period.

Fermentation time (day)
0510152025
Physicochemical propertiespH4.25±
0.01d1)2)
3.29±
0.01c
2.96±
0.01b
2.98±
0.01b
2.95±
0.01b
2.88±
0.01a
Soluble solids
(°Brix)
5.50±
0.00a
5.55±
0.14a
5.65±
0.14ab
5.65±
0.07ab
5.75±
0.07b
5.75±
0.00b
Total acidity
(%)
0.13±
0.14a
2.39±
0.09b
4.10±
0.02c
5.52±
0.00d
6.05±
0.08e
6.11±
0.02e
Organic acid
(mg% (w/v))
Acetic acid246.05±
25.66a
1,943.36±
54.79b
3,779.66±
52.53c
5,152.33±
109.19d
5,862.84±
79.52e
6,253.01±
21.03f
Succinic acid268.88±
8.99a
202.22±
6.74a
224.1±
38.74a
231.81±
53.95a
239.51±
51.12a
276.92±
0.57a
Citric acid117.81±
1.53a
128.71±
0.34a
155.75±
6.05ab
143.83±
27.21ab
145.96±
25.85ab
171.41±
1.15b
Pyroglutamic acid30.84±
2.33a
25.65±
2.08a
30.21±
0.48a
28.07±
7.59a
29.57±
7.12a
35.34±
0.08a
Total645.772,264.174,189.725,556.046,277.886,736.68
Ethanol (mg% (w/v))7,612.91±
81.85f
5,150.44±
51.77e
4,378.90±
28.11d
4,006.17±
34.03c
3,170.09±
0.99b
1,408.37±
30.65a

1)Values are mean±SD (n=3)..

2)Different small letters (a-f) in the same row indicate a significant difference according to Duncan’s multiple test (P<0.05)..



Fig 2. Changes in ginsenosides (G-Rg1, -Rb1, -Rg3, -Rg5) content of ginseng vinegar with different fermentation period. Error bar indicates the standard deviation of mean, and means with the same letter (a-e) are not significantly different according to Duncan’s multiple range test (P<0.05).

인삼농축액 발효식초의 이화학적 특성, 유기산 및 에탄올 함량

인삼농축액의 초산발효기간에 따른 이화학적 특성과 유기산 및 잔류 에탄올의 함량변화를 분석한 결과는 Table 2와 같다. pH는 발효 0일차 4.25에서 발효 25일차에 2.88로 유의적으로 감소하였는데, 이는 발효과정 중 생성된 유기산이 증가하였기 때문으로 판단된다. 수용성 고형분은 발효기간에 따라 증가하는 경향을 보였고, 인삼 진세노사이드에 결합되어 있는 당이 유리됨에 따른 증가로 추정된다. A. pasteurianus JBA190503 균주로 배양된 종초의 총 산도는 2.37%였고, 종초를 10% 첨가한 발효 0일차의 총 산도는 0.13%였다. 특히 진탕배양(30°C, 25일, 120 rpm) 조건에서 인삼농축액에 대한 초산균의 생육 저해는 나타나지 않아 발효 10일 이후 총 산도가 4.10%에 도달하였고, 발효 25일차에는 6.11%에 이르렀다. 식초의 품질 규격은 총 산도 기준으로 4.0%(w/v) 이상으로 고시되어 있지만(KFDA, 2012), 본 연구에서는 진세노사이드의 전환에 초산발효가 미치는 영향을 분석하고자 발효기간을 최대 25일까지 연장하여 발효를 종결하였다.

인삼농축액 발효식초의 주요 유기산은 acetic acid, succinic acid, citric acid, pyroglutamic acid 등으로 확인되었다(Table 2). Acetic acid는 발효 0일차 246.05 mg%에서 25일간 발효 후 약 27.40배 증가하여 6,253.01 mg%로 분석되었다. 또한 기능성 유기산인 citric acid가 인삼농축액에 함유되어 있어 발효 0일차에 117.81 mg%로 분석되었고, 초산발효기간 동안 증가하여 발효 25일차에는 171.41 mg%로 1.5배 증가하였다. Succinic acid 및 pyroglutamic acid는 초산발효기간 중 유의적인 변화를 보이지 않았다. 발효기간 동안 에탄올 함량은 발효 0일차에 7,612.91 mg% (w/v)로 분석되었으며 발효 25일차에는 1,408.37 mg% (w/v)였다. 결과적으로 소비된 에탄올의 함량은 6,204.54 mg%(w/v)였고, 생성된 acetic acid의 함량은 6,006.96 mg% (w/v)로 에탄올의 acetic acid로의 전환율은 약 96.81%였다.

세포독성 평가

마우스 유래 대식세포인 RAW 264.7 세포에 대한 세포독성 평가는 발효 25일차 발효물에 대해서 4% Na2CO3 용액으로 pH를 조정하여 발효 원액에 대한 희석배수 40~100배 수준에서 분석하였다(Fig. 3). 한편, control의 경우 에탄올을 제외한 조성비가 발효 0일차와 같고 에탄올의 독성을 고려하지 않아도 되기 때문에 발효 25일차 발효물과 동일한 희석배수에서 세포독성을 평가하였다. 인삼식초와 control의 세포독성은 ISO 10993-5(2009)의 방법을 참고하여 비처리구와 비교해 30% 이상 감소된 흡광도를 보이는 시료 처리농도를 확인하였고, 오차수준을 고려하여 세포생존율은 80% 이상 유지된 시료 처리농도를 선택하였다. 인삼농축액 발효식초(GV)의 세포생존율은 희석배수 1/100, 1/65, 1/50까지는 시료 비처리구의 생존율 대비 80% 이상의 생존율을 보였으나, 1/40 이상의 경우 80% 미만으로 생존율이 감소하였다. Control의 경우 희석배수 1/40에서도 생존율이 80% 이상으로 유지되었다. 이와 같은 결과는 GV에 잔존하는 에탄올과 acetate 함량이 control과 차이가 나기 때문으로 추정된다. 따라서 GV 시료 처리 시 세포생존율이 80% 이상 유지된 희석배수 1/100, 1/65, 1/50에서 control을 비교구로 하여 항염증 평가를 실시하였다.

Fig 3. Effect of ginseng vinegar on cell viability in RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50, 1/40 at diluted multiples) for 48 h. GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. Error bar indicates the standard deviation of mean, and means with the same letter (a-c) are not significantly different according to Duncan’s multiple range test (P<0.05).

NO 생성량 및 PGE2 정량

LPS의 자극에 의해 발현된 iNOS는 NO를 생성하게 되고 과도하게 생성된 NO는 염증반응을 촉진하며, LPS 및 cytokine에 의해 발현이 유도된 COX-2는 급성 염증반응에서 PGE2의 합성에 관여한다(Kang 등, 2015). 즉, 대식세포에 LPS를 처리하여 자극시키면 NO와 PGE2의 함량이 증가하고 함께 처리하는 시료가 이들의 생성을 억제하는 것으로 항염증 효과를 평가한다. 마우스 유래 대식세포인 RAW 264.7 세포에 LPS(1 µg/mL)와 함께 GV와 control을 세포독성이 확인되지 않은 희석배율 1/100, 1/65, 1/50로 첨가하여 NO 및 PGE2 생성량을 분석한 결과는 Fig. 4와 같다. RAW 264.7 세포에 LPS를 처리함에 따라 생성된 NO와 PGE2 함량은 각각 25.04 μM과 461.17 pg/mL였으며, GV를 1/100, 1/65, 1/50의 희석배율로 처리함에 따라 NO 함량은 11.97~5.54 μM, PGE2 함량은 405.88~389.41 pg/mL로 감소하였다. Control의 경우 1/100, 1/65, 1/50의 희석배율로 처리함에 따라 NO와 PGE2 함량은 각각 21.08~16.37 μM과 389.41~375.29 pg/mL로 감소하였다. GV와 control의 최고처리 희석배율인 1/50에서는 시료 비처리구에 비해서 NO 생성량이 각각 77.34%와 34.7% 감소하는 것으로 확인되었고, PGE2 함량은 각각 약 21.94%와 19.64%로 감소하였으나 농도 의존성은 보이지 않았다. GV의 경우 G-Rg3와 G-Rg5 등의 저분자 진세노사이드의 함량이 control에 비해 각각 4배와 3배 이상 증가하였고, 이에 따라 NO의 생성량이 감소한 것으로 판단된다(Shin 등, 2013).

Fig 4. Effect of ginseng vinegar on NO (A) and PGE2 (B) levels in LPS-stimulated RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50 at diluted multiples) then with LPS (1 μg/mL) for 24 h. -: not treated, +: treated, GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. NO: nitric oxide, PGE2: prostaglandin E2. Results are mean±SD of triplicate data. Error bar indicates the standard deviation of mean and means with the same letter (a-f) are not significantly different according to Duncan’s multiple range test (P<0.05). ND: not detected.

세포배양액의 TNF-α 및 IL-1β정량

전염증성 cytokine으로 분류되는 TNF-α와 IL-1β는 세포 내에서 생성된 후 세포 외로 이동하여 염증반응을 촉진하는 역할을 한다(Kim 등, 2017a). 따라서 세포 외로 이동된 TNF-α와 IL-1β의 함량을 분석한 결과는 Fig. 5와 같다. GV와 control의 TNF-α 발현량은 1/50배 희석배수에서 각각 8.06 ng/mL와 13.90 ng/mL였으며, 이는 시료 비처리구에 비해 69.15%와 46.80% 억제능을 보이는 수준이었다. 한편, GV와 control의 IL-1β 억제능은 1/50 희석배수에서 각각 91.76%와 76.29%였다. 또한, GV는 농도 의존적으로 IL-1β 저해 활성을 보였으나 control의 경우 1/100~1/50 희석배수에서 IL-1β 억제능이 유의적인 차이를 보이지 않아 IL-1β 생성억제 효과의 한계점이 약 80%로 추정된다.이와 같은 결과는 G-Rb1이 IL-1β의 생성억제 효과가 높고, control의 1/100 희석배수에 함유된 G-Rb1의 함량이 GV의 1/100과 1/65 희석배수에 비해 많기 때문인 것으로 판단된다(Cheng 등, 2013).

Fig 5. Effects of ginseng vinegar on TNF-α (A) and IL-1β (B) levels in LPS-stimulated RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50 at diluted multiples) then with LPS (1 μg/mL) for 24 h. -: not treated, +: treated, GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. TNF-α: tumor necrosis factor-α, IL-1β: interleukin-1β. Results are mean±SD of triplicate data. Error bar indicates the standard deviation of mean, and means with the same letter (a-f) are not significantly different according to Duncan’s multiple range test (P<0.05). ND: not detected.

iNOS 및 COX-2 mRNA 발현 비교

RAW 264.7 세포에 LPS 자극을 통해 염증반응을 유발하였을 경우, NO 및 PGE2의 생성량은 iNOS와 COX-2 발현량에 영향을 받는다. 따라서 세포 내 mRNA 수준에서 iNOS와 COX-2 발현 정도를 확인하기 위해 RT-PCR을 수행하였고 house keeping gene인 GAPDH를 양성 대조구로 하여 비교하였다(Fig. 6). iNOS는 LPS 비처리구(-)에서 발현되지 않았으나 LPS 처리구(+)에서는 70.03%의 발현량이 확인되었다. GV를 1/100, 1/65, 1/50 희석배수에서 처리하였을 때 iNOS의 발현량은 각각 39.21, 27.41, 27.15%로 감소하였고, 희석배수에 대한 발현량의 분산분석 및 동질성 검사 결과 1/100과 1/50의 희석배수에서 희석배수 의존적으로 유의하게 발현량이 감소하였다. 그러나 1/65과 1/50의 유의적인 차이는 없어 1/65 희석배수에서 iNOS 발현량이 시료 비처리구에 비해 42.62% 감소한 효과를 보였다. 또한, 1/50 희석배수에서 GV와 control 처리에 따른 iNOS 발현 억제능은 시료 비처리구 대비 각각 61.23%와 39.00% 수준이었다. COX-2의 발현량은 LPS 비처리구(-)와 LPS 처리구(+)가 각각 22.90%와 50.44%였으며 GV의 1/50 희석배수에서는 40.06%로 발현이 크게 감소하였다. 이러한 결과로 보아 GV의 iNOS 발현 억제에 의한 NO 생성량 감소와 COX-2 발현 억제에 의한 PGE2 생성 억제 효과가 1/50 희석배수에서 확인되었다. Kang 등(2018)은 인삼의 진세노사이드에 대한 항염증 연구에서 G-Rg3, -Rg5, -Rk1 등의 저분자 진세노사이드들이 G-Rb1의 항염증 효과보다 더 효과적이라 보고하였다. 본 연구에서는 초산발효를 통해 G-Rg3 및 G-Rg5 등의 전환이 증가하여 iNOS 및 COX-2의 mRNA 수준에서 발현이 감소하고, 이에 따라 염증반응이 억제된 것이라 판단된다(Lee, 2014).

Fig 6. Effects of ginseng vinegar on iNOS (A) and COX-2 (B) mRNA expression in LPS-stimulated RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50 at diluted multiples) then with LPS (1 μg/mL) for 24 h. The results were analyzed by RT-PCR. -: not treated, +: treated, GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. iNOS: inducible nitric oxide synthase, COX-2: cyclooxygenase-2, GAPDH: glyceraldehyde 3-phosphate dehydrogenase, LPS: lipopolysaccharides. Results are mean±SD of triplicate data. Error bar indicates the standard deviation of mean and means with the same letter (a-f) are not significantly different according to Duncan’s multiple range test (P<0.05). ND: not detected.

요 약

인삼농축액 발효식초 제조를 위한 인삼주(GL, 1% yeast extract, 9% 에탄올, 2% 인삼농축액)에 A. pasteurianus JBA190503 균주로 제조한 종초 10%(v/v)를 첨가하고, 진탕배양(30°C, 120 rpm, 25일)하여 초산발효 하였다. 인삼식초의 발효기간(25일)에 5일 간격으로 진세노사이드 함량변화와 이화학적 특성, 유기산 및 에탄올의 함량을 분석하였다. G-Rg3와 -Rg5의 함량은 0일차에 비해 25일차에 각각 4.64배, 3.80배 증가하였다. 인삼식초는 발효 10일차 총 산도가 4.10%에 도달하였으나, 25일까지 초산발효를 지속하여 진세노사이드의 함량변화를 분석하고 발효를 종결하였다. GV의 총 산도는 6.11%, acetic acid는 6,253.01 mg%였으며 초산 전환율은 96.81%였다. RAW 264.7 대식세포에 LPS 자극으로 염증을 유도하고 세포생존율이 80% 이상 확인된 GV와 control의 1/100, 1/65, 1/50의 희석액을 처리하여 항염증 효과를 평가하였다. GV의 처리는 희석배수 의존적으로 염증 관련 인자(NO, PGE2), 전염증성 cytokine (TNF-α, IL-1β) 생성 및 염증 관련 유전자(iNOS, COX-2)의 발현을 억제시켰다. 따라서 GV의 항염증 효과는 1/50 희석배수에서 비처리구 대비 NO, PGE2, TNF-α 및 IL-1β 생성을 각각 77.37%, 21.94%, 69.17% 및 91.76% 억제하였고, iNOS 및 COX-2의 mRNA 수준에서 발현을 61.23% 및 20.59% 억제하였다. 이러한 결과를 바탕으로 A. pasteurianus JBA190503 균주로 제조된 인삼농축액 발효식초는 상업용 식초로서 품질과 안전성이 확보된 항염증 효과가 증대된 기능성 식초로 기대된다.

감사의 글

본 논문은 농림축산식품부 지역 전략 식품산업 육성사업(과제명: 임산물 기반 동부권 발효식초개발, MIFI 2020-1)의 연구비 지원으로 이루어졌으며, 이에 감사드립니다.

Fig 1.

Fig 1.HPLC chromatogram of ginseng vinegar with different fermentation period. Ginsenoside (G) standard mix (50 μg/mL): G-Rg1, -Re, -Rf, -Rh1, -Rg2, -Rb1, -Rc, -Ra1, -Rb2, -Rb3, -Rd, -Rg3 (S), -Rk1, compound K (CK), -Rg5, GV_5day: ginseng vinegar fermented for 5 days, GV_15day: gingseng vinegar fermented for 15 days, GV_25day: ginseng vinegar fermented for 25 days.
Journal of the Korean Society of Food Science and Nutrition 2021; 50: 226-235https://doi.org/10.3746/jkfn.2021.50.3.226

Fig 2.

Fig 2.Changes in ginsenosides (G-Rg1, -Rb1, -Rg3, -Rg5) content of ginseng vinegar with different fermentation period. Error bar indicates the standard deviation of mean, and means with the same letter (a-e) are not significantly different according to Duncan’s multiple range test (P<0.05).
Journal of the Korean Society of Food Science and Nutrition 2021; 50: 226-235https://doi.org/10.3746/jkfn.2021.50.3.226

Fig 3.

Fig 3.Effect of ginseng vinegar on cell viability in RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50, 1/40 at diluted multiples) for 48 h. GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. Error bar indicates the standard deviation of mean, and means with the same letter (a-c) are not significantly different according to Duncan’s multiple range test (P<0.05).
Journal of the Korean Society of Food Science and Nutrition 2021; 50: 226-235https://doi.org/10.3746/jkfn.2021.50.3.226

Fig 4.

Fig 4.Effect of ginseng vinegar on NO (A) and PGE2 (B) levels in LPS-stimulated RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50 at diluted multiples) then with LPS (1 μg/mL) for 24 h. -: not treated, +: treated, GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. NO: nitric oxide, PGE2: prostaglandin E2. Results are mean±SD of triplicate data. Error bar indicates the standard deviation of mean and means with the same letter (a-f) are not significantly different according to Duncan’s multiple range test (P<0.05). ND: not detected.
Journal of the Korean Society of Food Science and Nutrition 2021; 50: 226-235https://doi.org/10.3746/jkfn.2021.50.3.226

Fig 5.

Fig 5.Effects of ginseng vinegar on TNF-α (A) and IL-1β (B) levels in LPS-stimulated RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50 at diluted multiples) then with LPS (1 μg/mL) for 24 h. -: not treated, +: treated, GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. TNF-α: tumor necrosis factor-α, IL-1β: interleukin-1β. Results are mean±SD of triplicate data. Error bar indicates the standard deviation of mean, and means with the same letter (a-f) are not significantly different according to Duncan’s multiple range test (P<0.05). ND: not detected.
Journal of the Korean Society of Food Science and Nutrition 2021; 50: 226-235https://doi.org/10.3746/jkfn.2021.50.3.226

Fig 6.

Fig 6.Effects of ginseng vinegar on iNOS (A) and COX-2 (B) mRNA expression in LPS-stimulated RAW 264.7 cells. The cells were treated with the indicated dilution factor of GV and control (1/100, 1/65, 1/50 at diluted multiples) then with LPS (1 μg/mL) for 24 h. The results were analyzed by RT-PCR. -: not treated, +: treated, GV: ginseng vinegar fermented for 25 days, control: ginseng vinegar fermented for 0 day without ethanol. iNOS: inducible nitric oxide synthase, COX-2: cyclooxygenase-2, GAPDH: glyceraldehyde 3-phosphate dehydrogenase, LPS: lipopolysaccharides. Results are mean±SD of triplicate data. Error bar indicates the standard deviation of mean and means with the same letter (a-f) are not significantly different according to Duncan’s multiple range test (P<0.05). ND: not detected.
Journal of the Korean Society of Food Science and Nutrition 2021; 50: 226-235https://doi.org/10.3746/jkfn.2021.50.3.226

Table 1 . The primer sequence used in the experiment.

Target geneGene full nameDirectionPrimer sequence (5′→3′)
iNOSInducible nitric oxide synthaseForwardATGTCCGAAGCAAACATCAC
ReverseTAATGTCCAGGAAGTAGGTG
COX-2Cyclooxygenase-2ForwardTGAGTACCGCAAACGCTTCTC
ReverseTGGACGAGGTTTTTCCACCAG
GAPDHGlyceraldehyde 3-phosphate dehydrogenaseForwardAGGTCATCCCAGAGCTGAACG
ReverseCACCCTGTTGCTGTAGCCGTAT

Table 2 . Physicochemical properties, organic acid and ethanol contents of ginseng vinegar with different fermentation period.

Fermentation time (day)
0510152025
Physicochemical propertiespH4.25±
0.01d1)2)
3.29±
0.01c
2.96±
0.01b
2.98±
0.01b
2.95±
0.01b
2.88±
0.01a
Soluble solids
(°Brix)
5.50±
0.00a
5.55±
0.14a
5.65±
0.14ab
5.65±
0.07ab
5.75±
0.07b
5.75±
0.00b
Total acidity
(%)
0.13±
0.14a
2.39±
0.09b
4.10±
0.02c
5.52±
0.00d
6.05±
0.08e
6.11±
0.02e
Organic acid
(mg% (w/v))
Acetic acid246.05±
25.66a
1,943.36±
54.79b
3,779.66±
52.53c
5,152.33±
109.19d
5,862.84±
79.52e
6,253.01±
21.03f
Succinic acid268.88±
8.99a
202.22±
6.74a
224.1±
38.74a
231.81±
53.95a
239.51±
51.12a
276.92±
0.57a
Citric acid117.81±
1.53a
128.71±
0.34a
155.75±
6.05ab
143.83±
27.21ab
145.96±
25.85ab
171.41±
1.15b
Pyroglutamic acid30.84±
2.33a
25.65±
2.08a
30.21±
0.48a
28.07±
7.59a
29.57±
7.12a
35.34±
0.08a
Total645.772,264.174,189.725,556.046,277.886,736.68
Ethanol (mg% (w/v))7,612.91±
81.85f
5,150.44±
51.77e
4,378.90±
28.11d
4,006.17±
34.03c
3,170.09±
0.99b
1,408.37±
30.65a

1)Values are mean±SD (n=3)..

2)Different small letters (a-f) in the same row indicate a significant difference according to Duncan’s multiple test (P<0.05)..


References

  1. Cheng LQ, Na JR, Bang MH, Kim MK, Yang DC. Conversion of major ginsenoside Rb1 to 20(S)-ginsenoside Rg3 by Microbacterium sp. GS514. Phytochemistry. 2008. 69:218-224.
    Pubmed CrossRef
  2. Cheng W, Wu D, Zuo Q, Wang Z, Fan W. Ginsenoside Rb1 prevents interleukin-1 beta induced inflammation and apoptosis in human articular chondrocytes. Int Orthop. 2013. 37: 2065-2070.
    Pubmed KoreaMed CrossRef
  3. Choi WY, Lee CG, Seo YC, Song CH, Lim HW, Lee HY. Effect of high pressure and steaming extraction processes on ginsenosides Rg3 and Rh2 contents of cultured-root in wild ginseng (Panax ginseng C. A. Meyer). Korean J Med Crop Sci. 2012. 20:270-276.
    CrossRef
  4. ISO 10993-5. Determination of cytotoxicity. In: Biological evaluation of medical devices-Part 5: Test for in vitro cytotoxicity. International Organization for Standardization, Geneva, Switzerland. 2009. p 9-10.
  5. Kang BK, Kim KBWR, Kim MJ, Bark SW, Park WM, Ahn NK, et al. Anti-inflammatory effect of Sargassum coreanum ethanolic extract through suppression of NF-κβ pathway in LPS induced RAW 264.7 cells in mice. Microbiol Biotechnol Lett. 2015. 43:112-119.
    CrossRef
  6. Kang KS, Ham J, Kim YJ, Park JH, Cho EJ, Yamabe N. Heatprocessed Panax ginseng and diabetic renal damage: active components and action mechanism. J Ginseng Res. 2013. 37: 379-388.
    Pubmed KoreaMed CrossRef
  7. Kang S, Park SJ, Lee AY, Huang J, Chung HY, Im DS. Ginsenoside Rg3 promotes inflammation resolution through M2 macrophage polarization. J Ginseng Res. 2018. 42:68-74.
    Pubmed KoreaMed CrossRef
  8. KFDA. Food code. Korea Food and Drug Administration, Osong, Korea. 2012. p 5-21.
  9. Kim HK, Cheon BS, Kim YH, Kim SY, Kim HP. Effects of naturally occurring flavonoids on nitric oxide production in the macrophage cell line RAW 264.7 and their structure-activity relationships. Biochem Pharmacol. 1999. 58:759-765.
    CrossRef
  10. Kim HW, Shin KS. Immunomodulatory and anti-metastatic activities of a crude polysaccharide isolated from Korean apple vinegar. Korean J Food Sci Technol. 2019. 51:152-159.
  11. Kim MJ, Kim KBWR, Park SH, Choi JS, Ahn DH. Anti-inflammatory effect of Chondria crassicaulis ethanol extract on MAPKs and NF-κβ signaling pathway in LPS-induced RAW 264.7 macrophages. Korean Soc Biotechnol Bioeng J. 2017a. 32:352-360.
    CrossRef
  12. Kim MK, Kim DY. Anti-inflammatory effect of barley leaf ethanol extract in LPS-stimulated RAW264.7 macrophage. Korean J Food Preserv. 2015. 22:735-743.
    CrossRef
  13. Kim MY, Lee JB, Yang BW, Park JD, Ko SK. The comparison of ginseng saponin composition and contents in steaming ginseng radix. Yakhak Hoeji. 2017b. 61:274-280.
    CrossRef
  14. Kim YS, Song GS. Characteristics of kiwifruit-added traditional kochujang. Korean J Food Sci Technol. 2002. 34:1091-1097.
  15. Ko SK, Lee KH, Hong JK, Kang SA, Sohn UD, Im BO, et al. Change of ginsenoside composition in ginseng extract by vinegar process. Food Sci Biotechnol. 2005. 14:509-513.
  16. Ko SR, Suzuki Y, Suzuki K, Choi KJ, Cho BG. Marked production of ginsenosides Rd, F2, Rg3, and compound K by enzymatic method. Chem Pharm Bull. 2007. 55:1522-1527.
    Pubmed CrossRef
  17. Lee SM. Anti-inflammatory effects of ginsenosides Rg5, Rz1, and Rk1: inhibition of TNF-α-induced NF-κB, COX-2, and iNOS transcriptional expression. Phytother Res. 2014. 28:1893-1896.
    Pubmed CrossRef
  18. MFDS (Ministry of Food and Drug Safety). 2017 Korea food safety. 2017 [cited 2020 Dec 03]. Available from: https://www.foodsafetykorea.go.kr/portal/safefoodlife/foodMeterial/foodMeterialDB.do?menu_grp=MENU_NEW04&menu_no=2968
  19. Nag SA, Qin JJ, Wang W, Wang MH, Wang H, Zhang R. Ginsenosides as anticancer agents: in vitro and in vivo activities, structure-activity relationships, and molecular mechanisms of action. Front Pharmacol. 2012. 3:25. https://doi.org/10.3389/fphar.2012.00025
    Pubmed KoreaMed CrossRef
  20. Nam KY, Choi JE, Park JD. Transformation techniques for the large scale production of ginsenoside Rg3. Korean J Med Crop Sci. 2013. 21:401-414.
    CrossRef
  21. Nam KY, Kim YS, Shon MY, Park JD. Recent advances in studies on chemical constituents and biological activities of Korean black ginseng (Panax ginseng C. A. Meyer). Kor J Pharmacogn. 2015. 46:173-188.
  22. Park H. The role of gut microbiota in ginsenoside metabolism and biotransformation of ginsenoside by lactic acid bacteria. Curr Top Lact Acid Bact Probiotics. 2019. 5:1-12.
    CrossRef
  23. Park JD. Recent studies on the chemical constituents of Korean ginseng (Panax ginseng C. A. Meyer). Korean J Ginseng Sci. 1996. 20:389-415.
  24. Ryu JH, An JH, Woo YK, Cho HJ. The anti-inflammation effects of A.C.C extracts on the LPS-induced RAW 264.7 cell. J Korea Acad-Indus Coop Soc. 2017. 18:503-511.
  25. Shin YM, Jung HJ, Choi WY, Lim CJ. Antioxidative, anti-inflammatory, and matrix metalloproteinase inhibitory activities of 20(S)-ginsenoside Rg3 in cultured mammalian cell lines. Mol Biol Rep. 2013. 40:269-279.
    Pubmed CrossRef
  26. Sung NH, Woo SM, Kwon JH, Yeo SH, Jeon YJ. Quality characteristics of high acidity apple vinegar manufactured using two stage fermentation. J Korean Soc Food Sci Nutr. 2014. 43:877-883.
    CrossRef